Skip to main content Skip to navigation
Oligo Mouse Anti-Human PVR (CD155)

BD™ AbSeq Oligo Mouse Anti-Human PVR (CD155)

Clone TX24 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Poliovirus receptor; HVED; Nectin-like protein 5; NECL5; NECL-5; PVS; TAGE4
2 µl
Mouse IgG2a
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCGGTGGATCGATGGGTATAGTTGGTAATTTGCGTC
AHS0111
Human PVR Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940102 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
TX24

The TX24 monoclonal antibody specifically binds to the Poliovirus Receptor (PVR) which is also known as CD155, Nectin-like protein 5 (NECL5). PVR is a ~70 kDa nectin-like type I transmembrane glycoprotein that belongs to the PVR-related (PRR) family within the Ig superfamily. In addition to two cell surface PVR isoforms (alpha and delta), two secreted PVR isoforms (beta and gamma) have been reported that share the same three Ig domains but differ in their C-termini. PVR is expressed on monocytes, macrophages, endothelial cells, epithelia cells, CD34+ thymocytes, and neurons. In addition to serving as a receptor for poliovirus and cytomegalovirus, PVR functions as an adhesion molecule involved in cell-cell and cell-matrix adhesion through interaction with CD96 (TACTILE), Nectin 1-3 (CD111, CD112, CD113), CD226, and vitronectin. PVR promotes natural killer (NK) cell adhesion to and lysis of target cells.

940102 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940102 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940102" on CiteAb

개발 참고 자료 (4)

  1. Freistadt MS, Fleit HB, Wimmer E. Poliovirus receptor on human blood cells: a possible extraneural site of poliovirus replication.. Virology. 1993; 195(2):798-803. (Biology). 참조 보기
  2. Fuchs A, Cella M, Giurisato E, Shaw AS, Colonna M. Cutting edge: CD96 (tactile) promotes NK cell-target cell adhesion by interacting with the poliovirus receptor (CD155).. J Immunol. 2004; 172(7):3994-8. (Biology). 참조 보기
  3. Pende D, Bottino C, Castriconi R, et al. PVR (CD155) and Nectin-2 (CD112) as ligands of the human DNAM-1 (CD226) activating receptor: involvement in tumor cell lysis.. Mol Immunol. 2005; 42(4):463-9. (Biology). 참조 보기
  4. Tahara-Hanaoka S, Shibuya K, Onoda Y et al. Functional characterization of DNAM-1 (CD226) interaction with its ligands PVR (CD155) and nectin-2 (PRR-2/CD112). Int Immunol. 2006; 16(4):533-538. (Biology). 참조 보기
940102 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.