Skip to main content Skip to navigation
Oligo Mouse Anti-Human IL-21 Receptor (CD360)

BD™ AbSeq Oligo Mouse Anti-Human IL-21 Receptor (CD360)

Clone 17A12 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Interleukin-21 receptor; CD360; NILR
50615
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGGTGGGTCTCGCGTACGTAATATAATAGGCTAATG
AHS0107
Human IL-21R Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940099 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
17A12

The 17A12 monoclonal antibody specifically binds to the IL-21 Receptor (IL-21R). The IL-21R, also known as CD360, is a 538 amino acid cytokine receptor with an extracellular domain consisting of one copy of the conserved WSXWS -containing cytokine-binding domain. The IL-21 receptor combines with the common cytokine-receptor γ-chain to form a functional receptor complex for IL-21. IL-21 is mainly produced by activated CD4+ T cells including T follicular helper (Tfh) cells. IL-21R is preferentially expressed by B cells, T cells, NK cells, some populations of myeloid cells, keratinocytes, and dendritic cells. Binding of its ligand, IL-21, in these cells results in the activation of the Jak/Stat signal transduction pathway.  The effects IL-21 ligand binding has pleiotropic actions such as augmenting the proliferation of T cells, driving of B cells into memory cells, terminally differentiating plasma cells and augmenting the activity of natural killer cells. IL-21 receptor has anti-tumor activity and might have a role in the development of autoimmunity; it has been reported that the IL-21 receptor affects the homeostasis of regulatory T cells and it could enhance T cell-activated responses in human immune-inflammatory diseases.

940099 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940099 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940099" on CiteAb

개발 참고 자료 (9)

  1. Asao H, Okuyama C, Kumaki S et al. Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol. 2001; 167(1):1-5. (Biology). 참조 보기
  2. Leonard WJ and Spolski R. Interleukin-21: A modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol. 2005; 5(9):688-698. (Biology). 참조 보기
  3. Mizuguchi M, Asao H, Hara T, Higuchi M, Fujii M, Nakamura M. Transcriptional activation of the interleukin-21 gene and its receptor gene by human T-cell leukemia virus type 1 Tax in human T-cells. J Biol Chem. 2009; 284(38):25501-25511. (Clone-specific: Flow cytometry). 참조 보기
  4. Nara H, Onoda T, Rahman M, et al. Regulation of interleukin-21 receptor expression and its signal transduction by WSB-2. Biochem Biophys Res Commun. 2010; 392(2):171-177. (Immunogen: Flow cytometry, Immunoprecipitation). 참조 보기
  5. Parrish-Novak J, Dillon SR, Nelson A, et al. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature. 2000; 408(6808):57-63. (Biology). 참조 보기
  6. Parrish-Novak J, Foster DC, Holly RD, Clegg CH. Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 2002; 72(5):856-863. (Biology). 참조 보기
  7. Peluso I, Fantini MC, Fina D et al. IL-21 counteracts the regulatory T cell-mediated suppression of human CD4+ T lymphocytes. J Immunol. 2007; 178(2):732-739. (Biology). 참조 보기
  8. Rahman M, Nara H, Onoda T et al. Cloning and characterization of an isoform of interleukin-21. FEBS Lett. 2007; 581(21):4001-4009. (Clone-specific: Flow cytometry). 참조 보기
  9. Wu Z, Kim HP, Xue HH, Liu H, Zhao K, Leonard WJ. Interleukin-21 receptor gene induction in human T cells is mediated by T-cell receptor-induced Sp1 activity. Mol Cell Biol. 2005; 25(22):9741-9752. (Biology). 참조 보기
모두 보기 (9) 간단히 보기
940099 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.