Skip to main content Skip to navigation
Oligo Mouse Anti-Human HVEM (CD270)

BD™ AbSeq Oligo Mouse Anti-Human HVEM (CD270)

Clone CW10 (also known as CW10) (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
TNFRSF14; HVEM; HVEA; LIGHTR ; ATAR ; TR2
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AACGATAGATTGCCGAAAGCGATAGAGATTGGAACG
AHS0105
Human Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940097 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
CW10

The CW10 monoclonal antibody specifically binds to HVEM (Herpes virus entry mediator). HVEM is also known as CD270, Tumor necrosis factor receptor-like 2 (TR2), or LIGHT Receptor (LIGHT-R). CD270 is a type I transmembrane protein and member of the TNF Receptor superfamily. It is encoded by TNFRSF14 (tumor necrosis factor receptor superfamily member 14). CD270 is expressed on T cells, B cells, NK cells, monocytes, granulocytes, and some dendritic cells. CD270 binds to Lymphotoxin α (LTa3/TNFβ), CD258/LIGHT, CD272/BTLA, and glycoprotein D of Herpes simplex viruses HSV-1 and HSV-2. CD270-LIGHT interactions can reportedly transduce costimulatory signals for T cells whereas CD270-BTLA interactions can deliver inhibitory signals to T cells.

940097 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940097 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940097" on CiteAb

개발 참고 자료 (6)

  1. Bender FC, Whitbeck JC, Ponce de Leon M, Lou H, Eisenberg RJ, Cohen GH. Specific association of glycoprotein B with lipid rafts during herpes simplex virus entry. J Virol. 2003; 77(17):9542-9552. (Immunogen). 참조 보기
  2. Gertner-Dardenne J, Fauriat C, Orlanducci F, et al. The co-receptor BTLA negatively regulates human Vgamma9Vdelta2 T-cell proliferation: a potential way of immune escape for lymphoma cells. Blood. 2013; 122(6):922-931. (Biology). 참조 보기
  3. Gonzalez LC, Loyet KM, Calemine-Fenaux J, et al. A coreceptor interaction between the CD28 and TNF receptor family members B and T lymphocyte attenuator and herpesvirus entry mediator. Proc Natl Acad Sci U S A. 2005; 102(4):1116-1121. (Biology). 참조 보기
  4. Montgomery RI, Warner MS, Lum BJ, Spear PG. Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family. Cell. 1996; 87(3):427-436. (Biology). 참조 보기
  5. Steinberg MW, Cheung TC, Ware CF. The signaling networks of the herpesvirus entry mediator (TNFRSF14) in immune regulation. Immunol Rev. 2011; 244(1):169-187. (Biology). 참조 보기
  6. Yu Z, Adusumilli PS, Eisenberg DP, et al. Nectin-1 expression by squamous cell carcinoma is a predictor of herpes oncolytic sensitivity. Mol Ther. 2007; 15(1):103-113. (Clone-specific: Flow cytometry, Functional assay, Inhibition). 참조 보기
모두 보기 (6) 간단히 보기
940097 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.