Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD95

BD™ AbSeq Oligo Mouse Anti-Human CD95

Clone DX2

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
APO-1; FAS; TNFRSF6; APT1; ALPS1A; FAS1; FASTM; FASLG receptor
355
2 µl
Mouse C3H, also known as C3H/He, C3H/Bi IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT
AHS0023
Human CD95-transfected L Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD95 Olgo AHS0023 DX2 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940037 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
DX2

The DX2 monoclonal antibody specifically binds to the human Fas antigen (also called APO-1). This 45 kDa type I transmembrane glycoprotein was designated as CD95 at the Fifth HLDA Workshop. Fas is a member of the TNF-receptor superfamily and is also known as Tumor necrosis factor receptor superfamily member 6 (TNFRSF6). It is differentially expressed on a variety of normal and neoplastic cells. These include some undifferentiated thymocytes, and activated T and B lymphocytes, natural killer (NK) cells, monocytes, neutrophils, fibroblasts, and cell lines. CD95 is preferentially expressed on CD45RO-positive memory T lymphocytes and γ/δ T lymphocytes. The Fas/CD95 antigen is a polypeptide that plays a role in the programmed sequence of events leading to cell death, termed apoptosis. Crosslinking CD95 with DX2 antibody delivers an apoptotic signal indicating that DX2 recognizes a functional epitope of the CD95 antigen.

940037 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940037 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (4)

  1. Cifone MG, De Maria R, Roncaioli P, et al. Apoptotic signaling through CD95 (Fas/Apo-1) activates an acidic sphingomyelinase. J Exp Med. 1994; 180(4):1547-1552. (Immunogen: Apoptosis, Functional assay). 참조 보기
  2. Itoh N, Yonehara S, Ishii A, et al. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell. 1991; 66(2):233-243. (Biology). 참조 보기
  3. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  4. Lanier LL, Chang C, Phillips JH. Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 1994; 153(6):2417-2428. (Clone-specific: Flow cytometry). 참조 보기
940037 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.