Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD94

BD™ AbSeq Oligo Mouse Anti-Human CD94

Clone HP-3D9

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
KLRD1; Killer cell lectin-like receptor subfamily D member 1; KP43
3824
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGGTTAGGATAGGTGTACGGGTCGAGTTGAATTCT
AHS0085
Human NK Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD94 Olgo AHS0085 HP-3D9 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940081 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
HP-3D9

The HP-3D9 monoclonal antibody specifically binds to CD94 which is also known as KP43. CD94 is expressed on the cell surface as a ~70 kDa, disulfide-linked, type II transmembrane glycoprotein dimer. It is encoded by KLRD1 (Killer cell lectin like receptor D1) which belongs to the C-type lectin superfamily. CD94 is expressed on natural killer (NK) cells, especially activated NK cells. It is also expressed on γ/δ TCR+ T lymphocytes, NK-T cells, and on some CD8+CD56+ α/β TCR+ cells. CD94 associates with various NKG2 receptors to form receptors for HLA class I molecules and plays a role in regulating cellular adhesion and activation. The HP-3D9 antibody can reportedly inhibit the cytolytic activity of activated NK cells.

940081 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940081 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (3)

  1. Aramburu J, Balboa MA, Ramírez A, et al. A novel functional cell surface dimer (Kp43) expressed by natural killer cells and T cell receptor-gamma/delta+ T lymphocytes. I. Inhibition of the IL-2-dependent proliferation by anti-Kp43 monoclonal antibody. J Immunol. 1990; 144(8):3238-3247. (Immunogen: Flow cytometry, Immunoprecipitation, Inhibition). 참조 보기
  2. Balboa MA, Balsinde J, Aramburu J, Mollinedo F, López-Botet M. Phospholipase D activation in human natural killer cells through the Kp43 and CD16 surface antigens takes place by different mechanisms. Involvement of the phospholipase D pathway in tumor necrosis factor alpha synthesis. J Exp Med. 1992; 176(1):9-17. (Clone-specific: Stimulation). 참조 보기
  3. Pérez-Villar JJ, Melero I, Rodríguez A, et al. Functional ambivalence of the Kp43 (CD94) NK cell-associated surface antigen. J Immunol. 1995; 154(11):5779-5788. (Clone-specific: Inhibition, Stimulation). 참조 보기
940081 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.