Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD66

BD™ AbSeq Oligo Mouse Anti-Human CD66

Clone B1.1/CD66 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CEA, carcinoembryonic antigen, CD66a, CD66c, CD66d, CD66e
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCTGCGCAAGGTAAGCTAAGTAACGAAAGGGATCT
AHS0094
Human Breast Carcinoma Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940088 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
B1.1/CD66

The B1.1 monoclonal antibody binds to several glycosylphosphatidylinositol-anchored glycoproteins present on granulocytes and epithelial cells. As reported in the Sixth International Workshop and Conference on Human Leucocyte Differentiation Antigens, the B1.1 antibody recognized CD66a (CEACAM1), CD66c (CEACAM6), CD66d (CEACAM3) and CD66e (CEACAM5). CD66 antigens belong to the carcinoembryonic antigen (CEA) family of molecules that are closely related to the immunoglobulin superfamily of glycoproteins. Studies on CD66 molecules suggest a potential adhesion function in vivo. These molecules exhibit both homophilic and heterophilic adhesion. CEA family members may be involved in transmembrane signaling and activation of neutrophils.

940088 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940088 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940088" on CiteAb

개발 참고 자료 (10)

  1. Colcher D, Hand PH, Nuti M, Schlom J. Differential binding to human mammary and nonmammary tumors of monoclonal antibodies reactive with carcinoembryonic antigen. Cancer Invest. 1983; 1(2):127-138. (Immunogen: Immunohistochemistry, Immunoprecipitation, Radioimmunoassay). 참조 보기
  2. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  3. Kuroki M, Arakawa F, Matsuo Y, et al. Molecular cloning of nonspecific cross-reacting antigens in human granulocytes. J Biol Chem. 1991; 266(18):11810-11817. (Biology). 참조 보기
  4. Kuroki M, Matsuo Y, Matsuoka Y. CD66 family Workshop: Reactivity of the CD66 Panel of monoclonal antibodies with soluble and membrane bound recombinant CD66 antigens. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:1009-1010.
  5. Maruyama K, Selmani Z, Ishii H, et al. Flt3 ligand enhances anti-tumor effects of antibody therapeutics. Int Immunopharmacol. 2012; 12:481-486. (Clone-specific: Flow cytometry). 참조 보기
  6. Nagel G, Grunert F, Kuijpers TW, Watt SM, Thompson J, Zimmermann W. Genomic organization, splice variants and expression of CGM1, a CD66-related member of the carcinoembryonic antigen gene family. Eur J Biochem. 1993; 214(1):27-35. (Biology). 참조 보기
  7. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  8. Skubitz KM, Grunert F, Jantscheff P, Kuroki M, Skubitz APN. CD66 family Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:992-1000.
  9. Szpak CA, Johnston WW, Lottich SC, Kufe D, Thor A, Schlom J. Patterns of reactivity of four novel monoclonal antibodies (B72.3, DF3, B1.1 and B6.2) with cells in human malignant and benign effusions. Acta Cytol. 1984; 28(4):356-367. (Clone-specific: Immunohistochemistry). 참조 보기
  10. Thompson JA, Grunert F, Zimmermann W. Carcinoembryonic antigen gene family: molecular biology and clinical perspectives. J Clin Lab Anal. 1991; 5(5):344-366. (Biology). 참조 보기
모두 보기 (10) 간단히 보기
940088 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.