Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD47

BD™ AbSeq Oligo Mouse Anti-Human CD47

Clone B6H12

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
IAP; CDw149; gp42; MER6; Neurophilin; OA3 ; Rh-related antigen
961
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTTAGGTTCGACGTATTATGTGTAGATCCGCAAGG
AHS0087
Purified human placental RGD-binding proteins
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD47 Olgo AHS0087 B6H12 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940082 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
B6H12

The B6H12 monoclonal antibody specifically binds to CD47, a 42-52 kDa N-linked glycan protein. CD47 antigen, also known as integrin-associated protein (IAP), is expressed on all hematopoietic cells, including leukocytes, platelets and erythrocytes. It is also expressed on epithelial cells, endothelial cells, fibroblasts and many tumor cell lines. CD47 may play a role as a signal transducer in the regulation of cation fluxes across cell membranes and in the chemotactic and adhesive interactions of leukocytes with endothelial cells. The B6H12 antibody is capable of blocking phagocytosis of microparticles by peripheral blood granulocytes. It has also been reported to induce proliferation of CD3-activated T cells.

940082 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940082 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (7)

  1. Brown E, Hooper L, Ho T, Gresham H. Integrin-associated protein: a 50-kD plasma membrane antigen physically and functionally associated with integrins. J Cell Biol. 1990; 111(6):2785-2794. (Clone-specific: Blocking, ELISA, Immunoaffinity chromatography, Immunoprecipitation, Western blot). 참조 보기
  2. Gresham HD, Goodwin JL, Allen PM, Anderson DC, Brown EJ. A novel member of the integrin receptor family mediates Arg-Gly-Asp-stimulated neutrophil phagocytosis. J Cell Biol. 1989; 108(5):1935-1943. (Immunogen: ELISA, Flow cytometry, Functional assay, Immunofluorescence, Inhibition). 참조 보기
  3. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  4. Lindberg FP, Gresham HD, Schwarz E, Brown EJ. Molecular cloning of integrin-associated protein: an immunoglobulin family member with multiple membrane-spanning domains implicated in alpha v beta 3-dependent ligand binding. J Cell Biol. 1993; 123(2):485-496. (Clone-specific: Flow cytometry, Immunoprecipitation). 참조 보기
  5. Lindberg FP, Lublin DM, Telen MJ, et al. Rh-related antigen CD47 is the signal-transducer integrin-associated protein. J Biol Chem. 1994; 269(3):1567-1570. (Clone-specific: Immunoaffinity chromatography). 참조 보기
  6. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  7. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
모두 보기 (7) 간단히 보기
940082 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.