Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD4

BD™ AbSeq Oligo Mouse Anti-Human CD4

Clone SK3 (also known as Leu3a)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
L3T4; Leu3a; T-cell surface antigen T4/Leu-3 ; W3/25 ; CD4 antigen (p55)
920
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCGGTGTTATGAGTAGGTCGTCGTGCGGTTTGATGT
AHS0032
Human Peripheral Blood T Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD4 Olgo AHS0032 SK3 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940001 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
SK3

The SK3 monoclonal antibody specifically binds to CD4. The CD4 antigen is a 55 kDa type 1 transmembrane glycoprotein that belongs to the immunoglobulin superfamily. It is expressed on T-helper/inducer lymphocytes and monocytes. CD3+CD4+ T cells comprise approximately 28% to 58% of normal peripheral blood lymphocytes. CD4 is also expressed on 80% to 95% of normal thymocytes. The CD4 antigen is present in low density on the cell surface of monocytes and in the cytoplasm of monocytes and macrophages (CD3-CD4+). CD4 serves as a T cell coreceptor for MHC class II antigen recognition and as a receptor for the human immunodeficiency virus (HIV). The SK3 antibody inhibits HIV binding to CD4+ cells.

940001 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940001 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. Bernard A, Boumsell L, Hill C. Joint report of the first international workshop on human leucocyte differentiation antigens by the investigators of the participating laboratories. In: Bernard A, Boumsell L, Dausset J, Milstein C, Schlossman SF, ed. Leucocyte Typing. New York, NY: Springer-Verlag; 1984:9-108.
  2. Engleman EG, Benike CJ, Glickman E, Evans RL. Antibodies to membrane structures that distinguish suppressor/cytotoxic and helper T lymphocyte subpopulations block the mixed leukocyte reaction in man. J Exp Med. 1981; 154(1):193-198. (Clone-specific: Functional assay, Inhibition). 참조 보기
  3. Evans RL, Wall DW, Platsoucas CD, et al. Thymus-dependent membrane antigens in man: inhibition of cell-mediated lympholysis by monoclonal antibodies to TH2 antigen. Proc Natl Acad Sci U S A. 1981; 78(1):544-548. (Immunogen: Flow cytometry, Inhibition). 참조 보기
  4. Reichert T, DeBruyere M, Deneys V, et al. Lymphocyte subset reference ranges in adult Caucasians. Clin Immunol Immunopathol. 1991; 60(2):190-208. (Biology). 참조 보기
  5. Sattentau QJ, Dalgleish AG, Weiss RA, Beverley PC. Epitopes of the CD4 antigen and HIV infection. Science. 1986; 234(4780):1120-1123. (Biology). 참조 보기
  6. Wood GS, Warner NL, Warnke RA. Anti–Leu-3/T4 antibodies react with cells of monocyte/macrophage and Langerhans lineage. J Immunol. 1983; 131(1):212-216. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940001 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.