Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD3

BD™ AbSeq Oligo Mouse Anti-Human CD3

Clone SK7 (also known as Leu-4)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CD3-epsilon; CD3E; Leu4; T-cell surface antigen T3/Leu-4 epsilon chain; T3E
916
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAAGGTAGAGTGTATTGACGTCGGTGTAGGTTGATT
AHS0033
Human Thymocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD3 Olgo AHS0033 SK7 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940000 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
SK7

The SK7 (Leu-4) monoclonal antibody specifically binds to the epsilon chain of the CD3 antigen/T-cell antigen receptor (TCR) complex. This complex is composed of at least six proteins that range in molecular weight from 20 to 30 kDa. The antigen recognized by CD3 antibodies is noncovalently associated with either α/β or γ/δ TCR (70 to 90 kDa). The CD3 antigen is present on 61% to 85% of normal peripheral blood lymphocytes 60% to 85% of thymocytes and on Purkinje cells in the cerebellum. The soluble form of this antibody has a mitogenic effect on most peripheral blood T lymphocytes, provided appropriate functional monocytes are present.

940000 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940000 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (11)

  1. Ernst DN, Shih CC. CD3 complex. J Biol Regul Homeost Agents. 2000; 14(3):226-229. (Biology). 참조 보기
  2. Kan EA, Wang CY, Wang LC, Evans RL. Noncovalently bonded subunits of 22 and 28 kd are rapidly internalized by T cells reacted with anti-Leu-4 antibody. J Immunol. 1983; 131(2):536-539. (Clone-specific: Flow cytometry, Functional assay, Immunofluorescence, Immunoprecipitation). 참조 보기
  3. Kaneoka H, Perez-Rojas G, Sasasuki T, Benike CJ, Engleman EG. Human T lymphocyte proliferation induced by a pan-T monoclonal antibody (anti-Leu 4): heterogeneity of response is a function of monocytes. J Immunol. 1983; 131(1):158-164. (Clone-specific: Activation, Functional assay, Stimulation). 참조 보기
  4. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  5. Knowles RW. Immunochemical analysis of the T-cell–specific antigens. In: Reinherz EL. Ellis L. Reinherz .. et al., ed. Leukocyte typing II. New York: Springer-Verlag; 1986:259-288.
  6. Kurrle R, Seyfert W, Trautwein A, Seiler FR. T cell activation by CD3 antibodies. In: Reinherz EL. Ellis L. Reinherz .. et al., ed. Leukocyte typing II. New York: Springer-Verlag; 1986:137-146.
  7. Lanier LL, Allison JP, Phillips JH. Correlation of cell surface antigen expression on human thymocytes by multi-color flow cytometric analysis: implications for differentiation. J Immunol. 1986; 137(8):2501-2507. (Clone-specific: Immunoprecipitation). 참조 보기
  8. Ledbetter JA, Evans RL, Lipinski M, Cunningham-Rundles C, Good RA, Herzenberg LA. Evolutionary conservation of surface molecules that distinguish T lymphocyte helper/inducer and cytotoxic/suppressor subpopulations in mouse and man. J Exp Med. 1981; 153(2):310-323. (Clone-specific: Immunoprecipitation). 참조 보기
  9. Ledbetter JA, Frankel AE, Herzenberg. Human Leu T-cell differentiation antigens: quantitative expression on normal lymphoid cells and cell lines. In: Hammerling G, Hammerling U, Kearney J, ed. Monoclonal Antibodies and T Cell Hybridomas: Perspectives and Technical News. New York: Elsevier/North Holland Biomedical Press; 1981:16-22.
  10. McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:1-1050.
  11. van Dongen JJM, Krissansen GW, Wolvers-Tettero ILM, et al. Cytoplasmic expression of the CD3 antigen as a diagnostic marker for immature T-cell malignanacies. Blood. 1988; 71(3):603-612. (Clone-specific: Immunofluorescence, Western blot). 참조 보기
모두 보기 (11) 간단히 보기
940000 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.