Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD273

BD™ AbSeq Oligo Mouse Anti-Human CD273

Clone MIH18

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
PD-1 ligand 2; PD-L2; B7-DC; PDCD1LG2; PDCD1 ligand 2; PDCD1L2; PDL2; Btdc
80380
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGTAACCGTATGTAATCCGTAATCGTAGAAGCGC
AHS0075
Human CD273 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD273 (PDL2) Olgo AHS0075 MIH18 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940071 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
MIH18

The MIH18 monoclonal antibody specifically binds to CD273 which is also known as the Programmed Death Ligand 2 (PD-L2) and B7-DC. CD273 is a type 1 transmembrane glycoprotein member of the B7 family and Ig superfamily. CD273 serves as a ligand for CD279, the Programmed Death 1 (PD-1) receptor. CD273 is expressed by dendritic cells, activated monocytes, medullary thymic epithelial cells, placental trophoblasts, and myocardial endothelium. CD273 can function as a coinhibitor of T cell functions by acting through CD279. Monoclonal antibodies that block the CD273 and CD279 interaction result in enhanced T cell proliferation and cytokine production. Thus, CD273 can play an important role in regulating T cell responses. Clone MIH18 is reportedly a blocking antibody.

940071 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940071 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (9)

  1. Bensussan A, Olive D. T-cell: section report.. Cell Immunol. 236(1-2):3-5. (Clone-specific: Flow cytometry). 참조 보기
  2. Brown JA, Dorfman DM, Ma FR, et al. Blockade of programmed death-1 ligand on dendritic cells enhances T cell activation and cytokine production. J Immunol. 2003; 170:1257-1266. (Biology). 참조 보기
  3. Carreno BM, Bennett F, Chau TA, et al. CTLA-4 (CD152) can inhibit T cell activation by two different mechanisms depending on its level of cell surface expression.. J Immunol. 2000; 165(3):1352-6. (Biology). 참조 보기
  4. Carter L, Fouser LA, Jussif J, et al. PD-1:PD-L inhibitory pathway affects both CD4(+) and CD8(+) T cells and is overcome by IL-2. Eur J Immunol. 2002; 32:634-643. (Biology). 참조 보기
  5. Latchman Y, Wood CR, Chernova T, et al. PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2001; 2(3):261-268. (Biology). 참조 보기
  6. Ohigashi Y, Sho M, Yamada Y, et al. Clinical significance of programmed death-1 ligand-1 and programmed death-1 ligand-2 expression in human esophageal cancer. Clin Cancer Res. 2005; 11:2947-2953. (Clone-specific: Immunohistochemistry). 참조 보기
  7. Pfistershammer K, Klauser C, Pickl WF, et al. No evidence for dualism in function and receptors: PD-L2/B7-DC is an inhibitory regulator of human T cell activation. Eur J Immunol. 2006; 36(5):1104-1113. (Clone-specific: Blocking, Flow cytometry, Functional assay). 참조 보기
  8. Youngnak P, Kozono Y, Kozono H, et al. Differential binding properties of B7-H1 and B7-DC to programmed death-1. Biochem Biophys Res Commun. 2003; 307(3):672-677. (Biology). 참조 보기
  9. Youngnak-Piboonratanakit P, Tsushima F, Otsuki N, et al. The expression of B7-H1 on keratinocytes in chronic inflammatory mucocutaneous disease and its regulatory role. Immunol Lett. 2004; 94(3):215-222. (Immunogen: Blocking, Flow cytometry, Immunofluorescence, Immunohistochemistry). 참조 보기
모두 보기 (9) 간단히 보기
940071 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.