Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD27

BD™ AbSeq Oligo Mouse Anti-Human CD27

Clone M-T271 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
TNFRSF7; TNF receptor superfamily, member 7; T14; Tp55; S152
939
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTCCGGTTTAGCGAATTGGGTTGAGTCACGTAGGT
AHS0025
Human T-CLL cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940018 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
M-T271

The M-T271 monoclonal antibody specifically binds to CD27. CD27 presents as  a type I transmembrane, disulphide-linked 110 kDa homodimer comprised of two polypeptide chains. The CD27 molecule is a lymphocyte-specific member of the TNF/NGF-R family, and is expressed on a subset of human thymocytes and on the majority of mature T lymphocytes, activated B cells and NK cells. CD27 is highly induced on T cells after TCR stimulation. CD27 binds to CD70 (also known as, CD27 ligand or CD27L) and may be involved in cellular interaction of T and B lymphocytes.

940018 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940018 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940018" on CiteAb

개발 참고 자료 (6)

  1. Bigler RD, Bushkin Y, Chiorazzi N. S152 (CD27). A modulating disulfide-linked T cell activation antigen. J Immunol. 1988; 141(1):21-28. (Biology). 참조 보기
  2. Bigler RD, Donat TL, Boselli CM. Definition of three epitopes of the CD27 molecule [P 120->55] present on activated normal lymphocytes. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:351-352.
  3. Kato K, Cantwell MJ, Sharma S, Kipps TJ. Gene transfer of CD40-ligand induces autologous immune recognition of chronic lymphocytic leukemia B cells. J Clin Invest. 1998; 101(5):1133-1141. (Clone-specific: ELISA, Flow cytometry). 참조 보기
  4. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  5. Morimoto C. Cluster report: CD27. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:356-357.
  6. Reiter C. T9. Cluster report: CD27. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:350.
모두 보기 (6) 간단히 보기
940018 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.