Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD24

BD™ AbSeq Oligo Mouse Anti-Human CD24

Clone ML5

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Heat Stable Antigen Homologue (HSA); Ba-1; CD24A
100133941
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT
AHS0042
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD24 Olgo AHS0042 ML5 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940028 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
ML5

The ML5 monoclonal antibody specifically binds to CD24 which is also known as CD24A, signal transducer CD24, small cell lung carcinoma cluster 4 antigen, or BA-1. CD24 is a 35-70 kDa glycophosphatidylinositol (GPI)-linked glycoprotein whose glycosylation pattern is highly variable and cell-type dependent. CD24 is expressed on neutrophils, eosinophils, dendritic cells, neural cells, epithelial cells, muscle cells, and many types of cancer cells. CD24 functions as an adhesion receptor. Several different ligands have been identified for CD24 including CD62P (P-selectin) which is expressed on activated platelets and activated endothelium. CD24 is variably expressed on all B lineage cells, except plasma cells, and can play a role in regulating the activation, proliferation or differentiation of these cells.

940028 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940028 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. Chtanova T, Tangye SG, Newton R, et al. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J Immunol. 2004; 173(1):68-78. (Clone-specific: Flow cytometry). 참조 보기
  2. Dörken B, Möller P, Pezzutto A, Schwartz-Albiez R, Moldenhauer G. B-cell antigens: CD24. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:82-83.
  3. McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:1-1050.
  4. Salamone MC, Rosselot C, Salamone GV, Barboza M, Kado M, Fainboim L. Antibodies recognizing CD24 LAP epitope on human T cells enhance CD28 and IL-2 T cell proliferation . J Leukoc Biol. 2001; 69(2):215-223. (Clone-specific: Flow cytometry). 참조 보기
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
모두 보기 (6) 간단히 보기
940028 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.