Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD21

BD™ AbSeq Oligo Mouse Anti-Human CD21

Clone B-ly4 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CR2; Complement receptor type 2; C3DR; EBV-R; Epstein-Barr virus receptor
1380
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTATTCGCGTATTGTCAGTCGGTAGGGTTATGGTCT
AHS0074
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940048 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
B-ly4

The B-ly4 monoclonal antibody specifically binds to CD21, a 145 kDa glycosylated type I integral membrane protein. CD21 is a receptor for the C3d complement fragment and for Epstein-Barr virus (EBV). CD21 is expressed on mature B cells, follicular dendritic cells, and some epithelial cells. It is also weakly expressed on the subset of mature T cells and thymocytes. CD21 plays a role in B-cell activation and proliferation. It may also play a role in modulating the function of T cells in the immune response to infections by lymphotropic viruses. Recently, CD21 was found to be part of a large complex containing CD19, CD81, and possibly other molecules.

940048 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940048 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940048" on CiteAb

개발 참고 자료 (6)

  1. Fearon DT. The CD19-CR2-TAPA-1 complex, CD45 and signaling by the antigen receptor of B lymphocytes. Curr Opin Immunol. 1993; 5(3):341-348. (Biology). 참조 보기
  2. Fischer E, Delibrias C, Kazatchkine MD. Expression of CR2 (the C3dg/EBV receptor, CD21) on normal human peripheral blood T lymphocytes. J Immunol. 1991; 146(3):865-869. (Biology). 참조 보기
  3. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  4. Paterson RL, Kelleher C, Amankonah TD, et al. Model of Epstein-Barr virus infection of human thymocytes: expression of viral genome and impact on cellular receptor expression in the T-lymphoblastic cell line, HPB-ALL. Blood. 1995; 85(2):456-464. (Biology). 참조 보기
  5. Timens W, Boes A, Vos H, Poppema S. Tissue distribution of the C3d/EBV-receptor: CD21 monoclonal antibodies reactive with a variety of epithelial cells, medullary thymocytes, and peripheral T-cells. Histochemistry. 1991; 95(6):605-611. (Clone-specific: Immunocytochemistry (cytospins), Immunohistochemistry). 참조 보기
  6. Tsoukas CD, Lambris JD. Expression of EBV/C3d receptors on T cells: biological significance. Immunol Today. 1993; 14(2):56-59. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940048 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.