Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD2

BD™ AbSeq Oligo Mouse Anti-Human CD2

Clone RPA-2.10 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
LFA-2; LFA-3 receptor; SRBC; T-cell surface antigen T11/Leu-5; erythrocyte receptor
914
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAACGTAGATTAGAGCCGGGTATGTCGCAACTGATT
AHS0029
Human Phytohemagglutinin-treated Lymphoblasts
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940046 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
RPA-2.10

The RPA-2.10 monoclonal antibody specifically binds to CD2 which is also known as Lymphocyte-function antigen-2 (LFA-2), LFA-3 receptor, Erythrocyte receptor, Sheep red blood cell (SRBC) receptor, or T-cell surface antigen T11/Leu-5. CD2 is a 50 kDa type I transmembrane glycoprotein. CD2 belongs to the immunoglobulin superfamily of proteins along with its primary ligand, LFA-3 (CD58). It is expressed on the surface of ~80-90% of human peripheral blood lymphocytes, greater than 95% of thymocytes, all T lymphocytes that form E-rosettes, and a subset of NK cells. CD2 functions as an adhesion receptor that binds to CD58 resulting in the activation of CD2-positive T cells and NK cells and in the regulation of their cytolytic activities.

940046 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940046 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940046" on CiteAb

개발 참고 자료 (7)

  1. Aversa GG, Bishop GA, Suranyi MG, Hall BM. RPA-2.10: an anti-CD2 monoclonal antibody that inhibits alloimmune responses and monitors T cell activation. Transplant Proc. 1987; 19(1):277-278. (Immunogen: Flow cytometry, Immunoprecipitation, Inhibition). 참조 보기
  2. Hahn WC, Burakoff SJ, Bierer BE. Signal transduction pathways involved in T cell receptor-induced regulation of CD2 avidity for CD58. J Immunol. 1993; 150(7):2607-2619. (Biology). 참조 보기
  3. Jonker M, Slingerland W. Reactivity of mAb specific for human CD markers with Rhesus monkey leucocytes. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1058-1063.
  4. Kato K. CD2 Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:39-43.
  5. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  6. Sopper S, Stahl-Hennig C, Demuth M, Johnston IC, Dorries R, ter Meulen V. Lymphocyte subsets and expression of differentiation markers in blood and lymphoid organs of rhesus monkeys. Cytometry. 1997; 29(4):351-362. (Clone-specific: Flow cytometry). 참조 보기
  7. Suranyi MG, Bishop GA, Clayberger C, et al. Lymphocyte adhesion molecules in T cell-mediated lysis of human kidney cells. Kidney Int. 1991; 39(2):312-319. (Clone-specific: Flow cytometry, Inhibition). 참조 보기
모두 보기 (7) 간단히 보기
940046 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.