Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD1c

BD™ AbSeq Oligo Mouse Anti-Human CD1c

Clone F10/21A3 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CD1; R7; M241; BDCA1
911
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATAGATTACATTCGTTTAGCGTTGGGTTCGGTCCGT
AHS0088
GM-CSF- and IL-4-activated Human Monocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940083 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
F10/21A3

The F10/21A3 monoclonal antibody specifically binds to CD1c. The CD1 family of transmembrane glycoproteins are structurally related to the classical major histocompatibility complex (MHC) proteins. CD1c is a type I transmembrane glycoprotein that forms heterodimers with beta-2-microglobulin. CD1c presents lipids and glycolipids of self or microbial origin to T cells. CD1c is expressed by Langerhans cells, dendritic cells, monocytes, cortical thymocytes, T cells, and some B cells.

940083 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940083 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940083" on CiteAb

개발 참고 자료 (4)

  1. Delia D, Cattoretti G, Polli N, et al. CD1c but neither CD1a nor CD1b molecules are expressed on normal, activated, and malignant human B cells: identification of a new B-cell subset. Blood. 1988; 72(1):241-247. (Biology). 참조 보기
  2. Grant EP, Degano M, Rosat JP, et al. Molecular recognition of lipid antigens by T cell receptors. J Exp Med. 1999; 189(1):195-205. (Clone-specific: Blocking, Functional assay, Inhibition). 참조 보기
  3. Melian A, Geng YJ, Sukhova GK, Libby P, Porcelli SA. CD1 expression in human atherosclerosis. A potential mechanism for T cell activation by foam cells. Am J Pathol. 1999; 155(3):775-786. (Immunogen: Flow cytometry). 참조 보기
  4. Moody DB, Ulrichs T, Mühlecker W, et al. CD1c-mediated T-cell recognition of isoprenoid glycolipids in Mycobacterium tuberculosis infection. Nature. 2000; 404(6780):884-888. (Clone-specific: Blocking, Functional assay, Inhibition). 참조 보기
940083 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.