Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD194

BD™ AbSeq Oligo Mouse Anti-Human CD194

Clone 1G1 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CCR4; C-C chemokine receptor type 4; CMKBR4; K5-5
1233
2 µl
Mouse C57BL/6 IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AATATTAGTGGGTCCTCGCGTTGGCCGGTTGTTAGT
AHS0038
Human CCR4 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940047 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
1G1

The 1G1 monoclonal antibody specifically binds to CD194, also known as the human CC Chemokine Receptor type 4 (CCR4).  CCR4 is expressed on activated Th2 cells, regulatory T cells, activated NK cells, basophils, monocytes and platelets.  CCR4 is a seven-transmembrane, G-protein-coupled receptor, and is the specific receptor for CC chemokines, CCL22/MDC/Macrophage-Derived Chemokine and CCL17/TARC/Thymus and Activation-Regulated Chemokine. It has been reported that CCR4 mRNA is expressed mainly in the thymus and spleen. The human CCR4 gene has been mapped to chromosome 3p24. The purified form of this antibody has been reported not to be a neutralizing antibody.  The immunogen used to generate the 1G1 hybridoma has been reported to be human CCR4 transfected L1.2 mouse lymphoma cells.

940047 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940047 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940047" on CiteAb

개발 참고 자료 (11)

  1. Andrew DP, Ruffing N, Kim CH, et al. C-C chemokine receptor 4 expression defines a major subset of circulating nonintestinal memory T cells of both Th1 and Th2 potential. J Immunol. 2000; 166(1):103-111. (Immunogen: Blocking, Flow cytometry, Functional assay, Inhibition). 참조 보기
  2. Bonecchi R, Bianchi G, Bordignon PP, et al. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med. 1998; 187(1):129-134. (Biology). 참조 보기
  3. Campbell JJ, Haraldsen G, Pan J, et al. The chemokine receptor CCR4 in vascular recognition by cutaneous but not intestinal memory T cells. Nature. 1999; 400(6746):776-780. (Biology). 참조 보기
  4. D'Ambrosio D, Iellem A, Bonecchi R, et al. Selective up-regulation of chemokine receptors CCR4 and CCR8 upon activation of polarized human type 2 Th cells.. J Immunol. 1998; 161(10):5111-5. (Biology). 참조 보기
  5. Imai T, Baba M, Nishimura M, Kakizaki M, Takagi S, Yoshie O. The T cell-directed CC chemokine TARC is a highly specific biological ligand for CC chemokine receptor 4. J Biol Chem. 1997; 272(23):15036-15042. (Biology). 참조 보기
  6. Imai T, Chantry D, Raport CJ, et al. Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor 4. J Biol Chem. 1998; 273(3):1764-1768. (Biology). 참조 보기
  7. Imai T, Nagira M, Takagi S, et al. Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine. Int Immunol. 1999; 11(1):81-88. (Biology). 참조 보기
  8. Power CA, Meyer A, Nemeth K, et al. Molecular cloning and functional expression of a novel CC chemokine receptor cDNA from a human basophilic cell line. J Biol Chem. 1995; 270(33):19495-19500. (Biology). 참조 보기
  9. Sallusto F, Lenig D, Mackay CR, Lanzavecchia A. Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. J Exp Med. 1998; 187(6):875-883. (Biology). 참조 보기
  10. Samson M, Soularue P, Vassart G, Parmentier M. The genes encoding the human CC-chemokine receptors CC-CKR1 to CC-CKR5 (CMKBR1-CMKBR5) are clustered in the p21.3-p24 region of chromosome 3. Genomics. 1996; 36(3):522-526. (Biology). 참조 보기
  11. Zola H, Swart B, Banham A, et al. CD molecules 2006--human cell differentiation molecules.. J Immunol Methods. 2007; 319(1-2):1-5. (Clone-specific). 참조 보기
모두 보기 (11) 간단히 보기
940047 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.