Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD184 (CXCR4)

BD™ AbSeq Oligo Mouse Anti-Human CD184 (CXCR4)

Clone 12G5 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CXCR4; Fusin; SDF-1 receptor; LAP3; LCR1; LESTR; NPYY3R; NPY3R; WHIM; HM89
7852
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGTGTTTAGAGCGGGTTGCATATGTCGTTTAGAGG
AHS0060
SIVmac variant CP-MAC-infected Sup-T1 cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940056 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
12G5

The 12G5 monoclonal antibody specifically binds to CD184, also known as CXCR4 and Fusin. CD184/CXCR4 is a seven-transmembrane domain, G-protein-linked, glycoprotein chemokine receptor. CD184 serves as a receptor for the C-X-C chemokine, SDF-1. It is expressed on a wide variety of hematopoietic cells including lymphoid and myeloid precursor cells, megakaryocytes, platelets, T and B lymphocytes, granulocytes, monocytes/macrophages, and dendritic cells. It is also expressed on vascular endothelial cells, epithelial cells, neurons and astrocytes. CD184 plays a variety of roles in hematopoiesis, vascularization and neural development. CD184 also functions as a coreceptor for infection with T-cell tropic strains of HIV-1 and as a receptor for CD4-independent infection by some HIV isolates. The 12G5 antibody has been reported to block CD4-independent infection by HIV-2 and CD4-dependent infection by some T-cell tropic isolates of HIV-1.

940056 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940056 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940056" on CiteAb

개발 참고 자료 (9)

  1. Bleul CC, Wu L, Hoxie JA, Springer TA, Mackay CR. The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes.. Proc Natl Acad Sci U S A. 1997; 94(5):1925-1930. (Clone-specific: Blocking, Flow cytometry, Functional assay, Inhibition, Neutralization). 참조 보기
  2. Endres MJ, Clapham PR, Marsh M, et al. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell. 1996; 87(4):745-756. (Immunogen: Blocking, Flow cytometry, Fluorescence microscopy, Functional assay, Immunofluorescence, Inhibition, Neutralization). 참조 보기
  3. Feng Y, Broder CC, Kennedy PE, Berger EA. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science. 1996; 272(5263):872-877. (Biology). 참조 보기
  4. Loetscher M, Geiser T, O'Reilly T, Zwahlen R, Baggiolini M, Moser B. Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes. J Biol Chem. 1994; 269(1):232-237. (Biology). 참조 보기
  5. Marcher C, Moller BK, Lillevang ST, Kristensen T. CXCR4 and IL17R are downregulated on cord-blood CD34-positive cells during short-term culture. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:629-632.
  6. McKnight A, Wilkinson D, Simmons G, et al. Inhibition of human immunodeficiency virus fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus strain dependent. J Virol. 1997; 71(2):1692-1696. (Clone-specific: Blocking, Flow cytometry, Functional assay, Inhibition, Neutralization). 참조 보기
  7. Simmons G, Wilkinson D, Reeves JD, et al. Primary, syncytium-inducing human immunodeficiency virus type 1 isolates are dual-tropic and most can use either Lestr or CCR5 as coreceptors for virus entry. J Virol. 1996; 70(12):8355-8360. (Biology). 참조 보기
  8. Vermont-Desroches C, Galea P, Marchand D, Clement C, Wijdenes J. Evaluation of anti-CXCR-4 Antibodies. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:247-249.
  9. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
모두 보기 (9) 간단히 보기
940056 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.