Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD161

BD™ AbSeq Oligo Mouse Anti-Human CD161

Clone DX12 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
KLRB1; CLEC5B; NKR; NKR-P1A: HNKR-P1a
3820
2 µl
Mouse C3H, also known as C3H/He, C3H/Bi IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTATGGTTGTCGGTAGAGTATCGTGTTGCGTTAGT
AHS0002
Human NKR-P1A Transfected Mouse Fibroblasts
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940070 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
DX12

The DX12 monoclonal antibody specifically binds to human CD161 which is also known as Natural killer cell surface protein P1A (NKR-P1A). CD161 is encoded by the KLRB1 (Killer cell lectin-like receptor subfamily B member 1) gene. CD161 is a member of the C-type lectin superfamily and is also referred to as C-type lectin domain family 5 member B (CLEC5B). CD161 is a 80 kDa disulfide-linked homodimer, type II membrane glycoprotein. CD161 is expressed mostly on NK cell populations and on subsets of CD4+ and CD8+ αβ T cells, NKT cells and γδ T cells. Reports indicate that CD161 is expressed preferentially on CD45RO+ T cells, however, it can be found on a subset of thymocytes and fetal liver T cells. Its function has not been fully elucidated, but reports indicate that NKR-P1A may serve as a specific receptor for some NK cell targets. The DX12 antibody can reportedly inhibit spontaneous cytotoxicity mediated by certain NK cell clones.

940070 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940070 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940070" on CiteAb

개발 참고 자료 (5)

  1. Ida H, Morita C, Porcelli S, Anderson P. CD161 workshop: Reactivity of workshop natural killer cell monoclonal antibodies on fresh and interleukin 2-activated peripheral blood natural killer cells and CD4-negative CD8-negative αβ and γδ T-cell clones. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:313-317.
  2. Lanier LL, Chang C, Phillips JH. Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 1994; 153(6):2417-2428. (Immunogen: Inhibition). 참조 보기
  3. Loza MJ, Metelitsa LS, Perussia B. NKT and T cells: coordinate regulation of NK-like phenotype and cytokine production. Eur J Immunol. 2002; 32(12):3453-3462. (Clone-specific: Flow cytometry). 참조 보기
  4. Poggi A, Revello V, Nanni L, Costa P, Moretta A. CD161 (human NKR-P1A) workshop panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:307-312.
  5. Ryan JC, Niemi EC, Nakamura MC, Seaman WE. NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J Exp Med. 1995; 181(5):1911-1915. (Biology). 참조 보기
940070 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.