Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD152

BD™ AbSeq Oligo Mouse Anti-Human CD152

Clone BNI3 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CTLA-4; AILIM; Cytotoxic T-lymphocyte protein 4
1493
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGTATCCGTAGTAGTTATCTGCCCGTTCGTTATGC
AHS0017
Human CTLA4 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Illumina is a trademark of Illumina, Inc.
  8. For U.S. patents that may apply, see bd.com/patents.
940034 Rev. 5
항체 세부 정보
Down Arrow Up Arrow
BNI3

The BNI3 monoclonal antibody specifically binds to the human cytolytic T lymphocyte-associated antigen (CTLA-4), also known as CD152. CTLA-4 is transiently expressed on activated CD28+ T cells and binds to CD80 and CD86 present on antigen presenting cells (APC) with high avidity. This interaction appears to deliver a negative regulatory signal to the T cell. Recent reports indicate that CTLA-4 is also expressed on B cells when cultured with activated T cells, suggesting a role for CTLA-4 in the regulation of B-cell response. Immobilized BNI3 antibody enhances T-cell proliferation induced by antibody-mediated crosslinking of CD3 and CD28. Recent studies have shown that CD152 can be expressed by regulatory T (Treg) cells. After cellular fixation and permeabilization, the BNI3 antibody can stain intracellular CD152 expressed in T cells including Treg cells. Clone BNI3 was studied in the VI Leukocyte Typing Workshop.

940034 Rev. 5
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940034 Rev.5
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940034" on CiteAb

개발 참고 자료 (10)

  1. Cabezon R, Sintes J, Llinas L, Benitez-Ribas D. Analysis of HLDA9 mAbs on plasmacytoid dendritic cell. Immunol Lett. 2011; 134(2):167-173. (Clone-specific: Flow cytometry). 참조 보기
  2. Castan J, Klauenberg U, Kalmar P, Fleischer B, Broker BM. Expression of CTLA-4 (CD152) on human medullary CD4+ thymocytes. Med Microbiol Immunol (Berl). 1998; 187(1):49-52. (Immunogen: Fluorescence microscopy, Immunocytochemistry, Immunofluorescence, Immunohistochemistry). 참조 보기
  3. Castan J, Tenner-Racz K, Racz P, Fleischer B, Broker BM. Accumulation of CTLA-4 expressing T lymphocytes in the germinal centres of human lymphoid tissues. Immunology. 1997; 90(2):265-271. (Immunogen: ELISA, Fluorescence microscopy, Immunofluorescence, Immunohistochemistry). 참조 보기
  4. Healy ZR, Murdoch DM. OMIP-036: Co-inhibitory receptor (immune checkpoint) expression analysis in human T cell subsets.. Cytometry A. 2016; 89(10):889-892. (Clone-specific: Intracellular Staining/Flow Cytometry). 참조 보기
  5. Kuiper HM, Brouwer M, Linsley PS, van Lier RA. Activated T cells can induce high levels of CTLA-4 expression on B cells. J Immunol. 1995; 155(4):1776-1783. (Biology). 참조 보기
  6. Lindsten T, Lee KP, Harris ES, et al. Characterization of CTLA-4 structure and expression on human T cells. J Immunol. 1993; 151(7):3489-3499. (Biology). 참조 보기
  7. Morton PA, Fu XT, Stewart JA, et al. Differential effects of CTLA-4 substitutions on the binding of human CD80 (B7-1) and CD86 (B7-2). J Immunol. 1996; 156(3):1047-1054. (Biology). 참조 보기
  8. Rabe H, Lundell AC, Andersson K, Adlerberth I, Wold AE, Rudin A. Higher proportions of circulating FOXP3+ and CTLA-4+ regulatory T cells are associated with lower fractions of memory CD4+ T cells in infants.. J Leukoc Biol. 2011; 90(6):1133-40. (Clone-specific: Intracellular Staining/Flow Cytometry). 참조 보기
  9. Santegoets SJ, Dijkgraaf EM, Battaglia A, et al. Monitoring regulatory T cells in clinical samples: consensus on an essential marker set and gating strategy for regulatory T cell analysis by flow cytometry.. Cancer Immunol Immunother. 2015; 64(10):1271-86. (Clone-specific: Intracellular Staining/Flow Cytometry). 참조 보기
  10. Wang H, Shih CC, Waters JB, et al. CD152 (CTLA4) Workshop: Expression and function of CD152 on human T cells: A study using a mouse anti-human CD152 monoclonal antibody BNI3.1. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:97-98.
모두 보기 (10) 간단히 보기
940034 Rev. 5

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.