Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD141

BD™ AbSeq Oligo Mouse Anti-Human CD141

Clone 1A4

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Thrombomodulin; TM; THBD; THRM; AHUS6; Fetomodulin; BDCA-3
7056
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGAAGTAAGTATGGGTCGGCGTAAATTGTGCGTGT
AHS0083
Purified Human Thrombomodulin
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD141 Olgo AHS0083 1A4 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940079 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
1A4

The 1A4 monoclonal antibody specifically binds to CD141. CD141 is a 75 kDa, single chain, type I membrane glycoprotein referred to as thrombomodulin and fetomodulin. CD141 is expressed on endothelial cells, smooth muscle cells, epithelial cells, synovial lining cells, and keratinocytes. It is also found on megakaryocytes, dendritic cells, peripheral blood monocytes, and neutrophils, but not on lymphocytes. Reports indicate that CD141 plays an important role in Protein C activation and the initiation of the Protein C anticoagulant pathway. Thrombin loses its procoagulant function when it binds to CD141, and the CD141/thrombin complex is able to activate Protein C.

940079 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940079 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (3)

  1. Chu M, Bird P. CD141 (thrombomodulin) Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:741-742.
  2. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  3. Teasdale MS, Bird CH, Bird P. Internalization of the anticoagulant thrombomodulin is constitutive and does not require a signal in the cytoplasmic domain. Immunol Cell Biol. 1994; 72(6):480-488. (Immunogen: Immunofluorescence, Immunoprecipitation, Western blot). 참조 보기
940079 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.