Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD126

BD™ AbSeq Oligo Mouse Anti-Human CD126

Clone M5

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Interleukin 6 Receptor alpha chain; IL-6R alpha; IL-6Rα
3570
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AATGGTGAATCGCCCTAGCAAGTGGTATCGGAATCG
AHS0096
CD126 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD126 Olgo AHS0096 M5 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940090 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
M5

The M5 monoclonal antibody specifically binds to human CD126 which is also known as the alpha subunit of the human IL-6 Receptor (IL-6Rα). CD126 is an 80 kDa type I transmembrane glycoprotein, also known as gp80 and B cell stimulatory factor-2 (BSF-2) Receptor. The IL-6Rα subunit associates with the 130-160 kDa gp130 subunit (IL-6 Receptor β chain, CD130), that is shared with the receptor complexes for Leukemia Inhibitory Factor (LIF), Ciliary Neurotropic Factor (CNTF), Oncostatin M (OSM), IL-11, Cardiotropin 1 (CT-1) and possibly Neurotrophin-1/B Cell-Stimulating Factor 3 (NNT-1/BSF-3).  The IL-6Rα chain binds IL-6 with low affinity; however the association with CD130 stabilizes the IL-6/IL-6Rα complex resulting in the formation of a high affinity ligand-receptor complex. The IL-6Rβ chain mediates signal transduction. CD126 is expressed at high levels by activated and EBV-transformed B cells, plasma cells and myeloma cells and at lower levels by most leucocytes, epithelial cells, fibroblasts, hepatocytes and neural cells. IL-6Rα exists in soluble form in human serum. The serum levels of soluble IL-6Rα appear to elevate in pathological situations such as multiple myeloma, Grave's disease, juvenile chronic arthritis and HIV. The M5 antibody is directed against an epitope not involved in interactions of CD126 with IL-6 or CD130.

940090 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940090 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (7)

  1. Autissier P, Liautard J, Brochier J, Gaillard JP. Activation of the gp130 signaling pathway by monoclonal antibodies directed against the gp130 molecule. Eur J Immunol. 1997; 27(3):794-797. (Biology). 참조 보기
  2. Brochier J, Liautard J, Jacquet C, Gaillard JP, Klein B. Optimizing therapeutic strategies to inhibit circulating soluble target molecules with monoclonal antibodies: example of the soluble IL-6 receptors. Eur J Immunol. 2001; 31(1):259-264. (Immunogen: ELISA, Immunoprecipitation, In vivo exacerbation). 참조 보기
  3. Gaillard JP, Liautard J, Duperray C, Brochier J. mAb against human gp80 IL-6 receptor. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:1891-1894.
  4. Gaillard JP, Mani JC, Liautard J, Klein B, Brochier J. Interleukin-6 receptor signaling. I. gp80 and gp130 receptor interaction in the absence of interleukin-6.. Eur Cytokine Netw. 1999; 10(1):43-8. (Clone-specific: ELISA, Functional assay). 참조 보기
  5. Liautard J, Gaillard JP, Mani JC, et al. Epitope analysis of human IL-6 receptor gp80 molecule with monoclonal antibodies.. Eur Cytokine Netw. 1994 May-June; 5(3):293-300. (Biology). 참조 보기
  6. Tupitsyn N, Kadagidze Z, Gaillard JP, et al. Functional interaction of the gp80 and gp130 IL-6 receptors in human B cell malignancies. Clin Lab Haematol. 1998; 20(6):345-352. (Clone-specific: Flow cytometry). 참조 보기
  7. Van Snick J. Interleukin-6: an overview. Annu Rev Immunol. 1990; 8:253-278. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940090 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.