Skip to main content Skip to navigation
Oligo Rat Anti-Mouse TIGIT

BD™ AbSeq Oligo Rat Anti-Mouse TIGIT

Clone TX99

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
T-cell immunoreceptor with Ig and ITIM domains; Tigit; V-set and transmembrane domain-containing protein 3; Vstm3
100043314
2 µl
Rat IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TATACTAAGAGAGAAGGTCGCGAGATGAACAATTGG
AMM2258
Mouse TIGIT Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms TIGIT Olgo AMM2258 TX99 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940458 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
TX99

The TX99 monoclonal antibody specifically binds to T cell immunoreceptor with Ig and ITIM domains (TIGIT), which is also known as V-set and transmembrane domain-containing protein 3 (Vstm3). TIGIT is a 26-kDa, type I transmembrane glycoprotein that belongs to the poliovirus receptor (PVR) family. TIGIT is expressed on activated and memory CD4+ T cells and CD8+ T cells, follicular T helper cells, regulatory T cells, and NK cells. Its ligands include the poliovirus receptor (PVR, aka, CD155), poliovirus receptor-related protein 2 (PVRL2, aka, CD112), and poliovirus receptor-related protein 3 (PVRL3, CD113). TIGIT functions as a negative regulator of T cell and NK cell responses including proliferation, cytotoxicity, and the production of proinflammatory cytokines. TIGIT-deficient mice are reportedly more susceptible to developing autoimmune diseases in certain model systems.

940458 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940458 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Joller N, Lozano E, Burkett PR, et al.. Treg cells expressing the coinhibitory molecule TIGIT selectively inhibit proinflammatory Th1 and Th17 cell responses. Immunity. 2014; 40(4):569-581. (Biology). 참조 보기
  2. Levin SD, Taft DW, Brandt CS, et al. Vstm3 is a member of the CD28 family and an important modulator of T-cell function. Eur J Immunol. 2011; 41(4):902-915. (Biology). 참조 보기
  3. Manieri NA, Chiang EY, Grogan JL. TIGIT: A Key Inhibitor of the Cancer Immunity Cycle.. Trends Immunol. 2017; 38(1):20-28. (Biology). 참조 보기
  4. Nakamura Y, Naito K, Yamashita-Kanemaru Y, et al. TX99 Is a Neutralizing Monoclonal Antibody Against Mouse TIGIT.. Monoclon Antib Immunodiagn Immunother. 2018; 37(2):105-109. (Immunogen: Blocking, Flow cytometry, Functional assay, Inhibition). 참조 보기
  5. Yu X, Harden K, Gonzalez LC, Francesco M, et al. The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat Immunol. 2009; 10(1):48-57. (Biology). 참조 보기
940458 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.