Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Panendothelial Cell Antigen

BD™ AbSeq Oligo Rat Anti-Mouse Panendothelial Cell Antigen

Clone MECA-32

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Plvap; Pv1; MECA32; Plasmalemma vesicle-associated protein
84094
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTTGTATTCGGGTTGTGAGTTGCTGCGGTAAGTTG
AMM2149
Mouse lymph node stromal cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms PANEN ATG Olgo AMM2149 MECA-32 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940348 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
MECA-32

The MECA-32 antibody reacts with a dimer of 50-55–kDa subunits expressed on most or all endothelial cells in the embryonic and adult mouse, with the exception of cardiac and skeletal muscle and the brain. Normally in skeletal and cardiac muscle, MECA-32 antigen expression is limited to small arterioles and venules; however, under conditions of inflammation, it can be induced on previously non-expressing vessels in cardiac muscle. In the central nervous system (CNS), the panendothelial cell antigen expression is developmentally regulated. During embryonic development, the antigen is found on brain vasculature up to day 16 of gestation, after which it disappears. The cessation of MECA-32 antigen expression in the CNS may be associated with the establishment of the blood-brain barrier, which begins on day 16 of gestation. In the adult mouse,  inflammation in the CNS can lead to re-expression of the panendothelial cell antigen.

940348 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940348 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Bergese SD, Pelletier RP, Ohye RG, Vallera DA, Orosz CG. Treatment of mice with anti-CD3 mAb induces endothelial vascular cell adhesion molecule-1 expression. Transplantation. 1994; 57(5):711-717. (Biology). 참조 보기
  2. Engelhardt B, Conley FK, Butcher EC. Cell adhesion molecules on vessels during inflammation in the mouse central nervous system. J Neuroimmunol. 1994; 51(2):199-208. (Biology). 참조 보기
  3. Hallmann R, Mayer DN, Berg EL, Broermann R, Butcher EC. Novel mouse endothelial cell surface marker is suppressed during differentiation of the blood brain barrier. Dev Dyn. 1995; 202(4):325-332. (Biology). 참조 보기
  4. Leppink DM, Bishop DK, Sedmak DD, et al. Inducible expression of an endothelial cell antigen on murine myocardial vasculature in association with interstitial cellular infiltration. Transplantation. 1989; 48(5):874-877. (Immunogen). 참조 보기
  5. Orosz CG, van Buskirk A, Sedmak DD, Kincade P, Miyake K, Pelletier RP. Role of the endothelial adhesion molecule VCAM in murine cardiac allograft rejection. Immunol Lett. 1992; 32(1):7-12. (Biology). 참조 보기
940348 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.