Skip to main content Skip to navigation
Oligo Rat Anti-Mouse MAdCAM-1

BD™ AbSeq Oligo Rat Anti-Mouse MAdCAM-1

Clone MECA-367 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Madcam1; MADCA; mucosal vascular addressin cell adhesion molecule 1
17123
2 µl
Rat WI, also known as Wistar (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGACCGAATGATGTATGGCGATGAGTTATGCTATGT
AMM2150
Mouse endothelial cells from BALB/c mouse mesenteric and peripheral lymph nodes.
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940349 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
MECA-367

The MECA-367 monoclonal antibody specifically recognizes mucosal vascular addressin MAdCAM-1. In the fetus and neonate, MAdCAM-1 is the predominant vascular addressin on the high endothelial venules (HEV) of peripheral lymph nodes. In adult mice, MAdCAM-1 is preferentially expressed in mucosal lymphoid tissues and lamina propria; it is also expressed on sinus-lining cells in the spleen. MAdCAM-1 expression is upregulated on the HEV of peripheral lymph nodes in adult NOD mice4 and is involved in the development of diabetes and insulitis. Furthermore, there is evidence that IFN-γ can induce MAdCAM-1 expression in non-mucosal sites in adult mice. MAdCAM-1 is a predominant ligand for integrin α4β7, a lymphocyte mucosal homing receptor, and a facultative ligand for CD62L (L-selectin). MECA-367 mAb binds to the first domain of MAdCAM-1 and blocks MAdCAM-1-dependent binding in vitro and lymphocyte homing to Peyer's patch HEV in vivo. Source of the immunogen was endothelial cells from BALB/c mouse mesenteric and peripheral lymph nodes.

940349 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940349 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940349" on CiteAb

개발 참고 자료 (5)

  1. Berg EL, McEvoy LM, Berlin C, Bargatze RF, Butcher EC. L-selectin-mediated lymphocyte rolling on MAdCAM-1. Nature. 1993; 366(6456):695-698. (Biology). 참조 보기
  2. Berlin C, Berg EL, Briskin MJ, et al. Alpha 4 beta 7 integrin mediates lymphocyte binding to the mucosal vascular addressin MAdCAM-1. Cell. 1993; 74(1):185-195. (Biology). 참조 보기
  3. Briskin MJ, McEvoy LM, Butcher EC. MAdCAM-1 has homology to immunoglobulin and mucin-like adhesion receptors and to IgA1. Nature. 1993; 363(6428):461-464. (Biology). 참조 보기
  4. Kraal G, Schornagel K, Streeter PR, Holzmann B, Butcher EC. Expression of the mucosal vascular addressin, MAdCAM-1, on sinus-lining cells in the spleen. Am J Pathol. 1995; 147(3):763-771. (Biology). 참조 보기
  5. Streeter PR, Berg EL, Rouse BT, Bargatze RF, Butcher EC. A tissue-specific endothelial cell molecule involved in lymphocyte homing. Nature. 1988; 331(6151):41-46. (Immunogen). 참조 보기
940349 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.