Skip to main content Skip to navigation
Oligo Rat Anti-Mouse IL-17 Receptor B

BD™ AbSeq Oligo Rat Anti-Mouse IL-17 Receptor B

Clone 6B7 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
IL-17RB; IL-17B receptor; Il17rb; Evi27; Il17rb; IL-17ER; IL17RH1; IL-17Rh1
50905
2 µl
Rat IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACGGCGTTAGGTATTGTCTTGTATTAGTAGGCGGCT
AMM2113
Mouse IL-17 Receptor B Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940329 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
6B7

The 6B7 monoclonal antibody specifically binds to IL-17 Receptor B (IL-17RB), which is a single-pass type I transmembrane protein and a component of the heterodimeric receptor for IL-25 (also known as IL-17E). Several components of the IL-17RB signaling mechanism have been identified, including ACT1, TRAF4, SMURF2, DAZAP2, and STAT5. The cytoplasmic tails of both of the IL-25 Receptor components, IL-17RA and IL-17RB, and ACT1 contain the SEFIR (similar expression to fibroblast growth factor genes and IL-17R) domain that is essential for IL-25R-mediated signaling. Signaling through IL-17RB mediates Th2 immune responses and is responsible for pathogenesis in a murine model for asthma. IL-17RB is found on subsets of iNKT cells, Th2 cells, some myeloid cells in solid organs, and type 2 innate lymphoid cells (ILC2) in lung, peritoneum, mesenteric lymph nodes and bone marrow.

940329 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940329 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940329" on CiteAb

개발 참고 자료 (5)

  1. Hoyler T, Klose CS, Souabni A, et al. The transcription factor GATA-3 controls cell fate and maintenance of type 2 innate lymphoid cells.. Immunity. 2012; 37(4):634-48. (Biology). 참조 보기
  2. Terashima A, Watarai H, Inoue S, et al. A novel subset of mouse NKT cells bearing the IL-17 receptor B responds to IL-25 and contributes to airway hyperreactivity.. J Exp Med. 2008; 205(12):2727-33. (Biology). 참조 보기
  3. Wu L, Zepp JA, Qian W, et al. A novel IL-25 signaling pathway through STAT5.. J Immunol. 2015; 194(9):4528-34. (Biology). 참조 보기
  4. Zepp JA, Wu L, Qian W, et al. TRAF4-SMURF2-mediated DAZAP2 degradation is critical for IL-25 signaling and allergic airway inflammation.. J Immunol. 2015; 194(6):2826-37. (Biology). 참조 보기
  5. Zhang B, Liu C, Qian W, Han Y, Li X, Deng J. Crystal structure of IL-17 receptor B SEFIR domain.. J Immunol. 2013; 190(5):2320-6. (Biology). 참조 보기
940329 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.