제품 세부 정보
BD™ AbSeq
Ighg2a; Immunoglobulin gamma-2a heavy chain; Igh-1; Igh-1a
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TATGAGAGTCGTTGGGCTTATGTGAGTTGTAGTGGG
AMM2217
Pooled BALB/c and C57BL/6 mouse Ig
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
준비 및 보관
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
권장 분석 절차
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.
BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
제품 고시
- This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
- Source of all serum proteins is from USDA inspected abattoirs located in the United States.
- Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
- The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
- Illumina is a trademark of Illumina, Inc.
- Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
- Please refer to bd.com/genomics-resources for technical protocols.
- For U.S. patents that may apply, see bd.com/patents.
관련 제품
Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) RUO
사이즈
0.1 mg
카탈로그 No.
553141
Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) RUO
사이즈
0.5 mg
카탈로그 No.
553142
Stain Buffer (FBS) RUO
사이즈
500 ML
카탈로그 No.
554656
Single-Cell Analysis System RUO
사이즈
1 EA
카탈로그 No.
633701
Express Single-Cell Analysis System Package RUO
사이즈
1 EA
카탈로그 No.
633707
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈
1 Each
카탈로그 No.
633772
940441 Rev. 2
항체 세부 정보
R19-15
The R19-15 antibody recognizes an epitope in the CH3 domain of mouse IgG2a, with strong reactivity to the Igh-I[a] allotype and weaker reactivity to Igh-I[b]. It does not react with other Ig isotypes. Molecular genetic analyses suggest that the Igh-I[b] allele, which encodes IgG2a[b], is derived from a locus found in several wild mouse subspecies, but not domestic mice, which encodes the IgG2c isotype.
940441 Rev. 2
형광 세부 정보
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940441 Rev.2
인용 및 참고 문헌
View product citations for antibody "940441" on CiteAb
개발 참고 자료 (4)
-
Buono C, Binder CJ, Stavrakis G, Witztum JL, Glimcher LH, Lichtman AH. T-bet deficiency reduces atherosclerosis and alters plaque antigen-specific immune responses.. Proc Natl Acad Sci USA. 2005; 102(5):1596-601. (Clone-specific: ELISA). 참조 보기
-
Justement LB, Kreiger J, Cambier JC. Production of multiple lymphokines by the A20.1 B cell lymphoma after cross-linking of membrane Ig by immobilized anti-Ig.. J Immunol. 1989; 143(3):881-9. (Clone-specific: Activation, Flow cytometry, Functional assay, Stimulation). 참조 보기
-
Martin RM, Silva A, Lew AM. The Igh-1 sequence of the non-obese diabetic (NOD) mouse assigns it to the IgG2c isotype. Immunogenetics. 1997; 46(2):167-168. (Biology). 참조 보기
-
Morgado MG, Cam P, Gris-Liebe C, Cazenave PA, Jouvin-Marche E. Further evidence that BALB/c and C57BL/6 gamma 2a genes originate from two distinct isotypes. EMBO J. 1989; 8(11):3245-3251. (Biology). 참조 보기
940441 Rev. 2
Please refer to Support Documents for Quality Certificates
Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described
Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.
For Research Use Only. Not for use in diagnostic or therapeutic procedures.