Skip to main content Skip to navigation
Oligo Rat Anti-Mouse FR4 (Folate receptor 4)

BD™ AbSeq Oligo Rat Anti-Mouse FR4 (Folate receptor 4)

Clone 12A5 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Folate receptor 4, FBP, FBP3, FRdelta, FRd
64931
2 µl
Rat WI, also known as Wistar (outbred) IgG1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCGTAGGTTTGGCGGAGTAGAAGTAAGTTGGATTGC
AMM2196
Mouse CD4+ CD25+ T cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940436 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
12A5

The monoclonal antibodies TH6 and 12A5 recognize Folate Receptor 4 (FR4), also known as the membrane folate-binding protein 3 (FBP3). FR4 is a heavily glycosylated 35 kD receptor expressed exclusively in lymphoid tissue and an isoform of the family of receptors that recognize the essential nutrient folic acid. Natural T regulatory cells constitutively express high levels of FR4.  Differential expression of FR4 in combination with CD25 can distinguish four functionally distinct CD4+ T cell subpopulations; Natural Tregs, effector T cells, memory-like T cells and Naïve T cells. FR4hi CD25+ expressing CD4+ T cells also express high amounts of Foxp3, GITR and CTLA-4.

Monoclonal antibody TH6 and 12A5 stained CD25+CD4+ T cells at a higher level than other CD4+ or CD8+ T cells. In addition, in vivo injection of TH6 monoclonal antibody reduced the number of CD25+CD4+ T cells and CD25-CD4+ T cells in peripheral blood. Clone 12A5 has been demonstrated to work in western blot. Clones TH6 and 12A5 do not block one another in a flow cytometric assay.

940436 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940436 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940436" on CiteAb

개발 참고 자료 (3)

  1. Rothberg KG, Ying YS, Kolhouse JF, Kamen BA, Anderson RG. The glycophospholipid-linked folate receptor internalizes folate without entering the clathrin-coated pit endocytic pathway. J Cell Biol. 1990; 110(3):637-649. (Biology). 참조 보기
  2. Spiegelstein O, Eudy JD, Finnell RH. Identification of two putative novel folate receptor genes in humans and mouse. Gene. 2000; 258(1-2):117-125. (Biology). 참조 보기
  3. Yamaguchi T, Hirota K, Nagahama K, et al. Control of immune responses by antigen-specific regulatory T cells expressing the folate receptor.. Immunity. 2007; 27(1):145-59. (Immunogen: Flow cytometry, Western blot). 참조 보기
940436 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.