Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD71

BD™ AbSeq Oligo Rat Anti-Mouse CD71

Clone C2 (also known as C2F2)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Transferrin Receptor; TR; TfR; TfR1; Tfrc; Trfr; Mtvr-1
22042
2 µl
Rat WF, also known as Wistar Furth IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTAGGAATGCGGTATGGAACAGTATCGAATGAGCGG
AMM2059
Mouse cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD71 Olgo AMM2059 C2 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940163 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
C2

The C2 monoclonal antibody specifically binds to CD71, the transferrin receptor. CD71 is a disulfide-linked homodimer of 95-kDa subunits. CD71 mediates one of the cellular mechanisms for iron uptake, and its expression is regulated according to the cell's iron requirements. It is expressed at high levels on developing erythroid cells, and it is upregulated after mitogenic activation of B or T lymphocytes. The C2 monoclonal antibody selectivity inhibits some types of T- and B-cell activation by down-regulation of transferrin receptor expression, but it does not block binding of transferrin.

940163 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940163 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (4)

  1. Makita S, Kanai T, Oshima S, et al. CD4+CD25bright T cells in human intestinal lamina propria as regulatory cells. J Immunol. 2004; 173(5):3119-3130. (Clone-specific: Flow cytometry). 참조 보기
  2. Ni J, Hembrador E, Di Bisceglie AM, et al. Accumulation of B lymphocytes with a naive, resting phenotype in a subset of hepatitis C patients. J Immunol. 2003; 170(6):3429-3439. (Clone-specific: Flow cytometry). 참조 보기
  3. Schwarting R, Stein H. Cluster report: CD71. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:455-460.
  4. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
940163 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.