Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD62E

BD™ AbSeq Oligo Rat Anti-Mouse CD62E

Clone 10E9.6 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Sele; E-selectin; Elam; ELAM-1; LECAM2; LYAM2
20339
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATCAGGTGGTTAATATACGTTGGGTTCGGGAGGTTG
AMM2135
Mouse brain capillary endothelioma bEnd.3 (TNFα-stimulated)
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940404 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
10E9.6

The 10E9.6 monoclonal antibody specifically binds to the 97-110 kDa cell surface glycoprotein E-selectin (CD62E), also known as endothelial-leukocyte adhesion molecule-1 (ELAM-1), which is expressed on endotoxin- or cytokine-stimulated mouse endothelial cells.  A suspension of TNFα stimulated mouse brain capillary endothelioma cells, from the cell line bEnd.3, was used as the immunogen.  The epitope recognized by mAb 10E9.6 has been mapped to the first and/or second complement regulatory protein repeat domains of E-selectin. The 10E9.6 antibody has been reported to block binding of a monocyte cell line to E-selectin in vitro and to block neutrophil migration in BALB/c, but not C57BL/6 mice. It has no effect on leukocyte rolling in TNFα-treated mouse venules or on in vitro adhesion of myeloid cells to E-selectin. Studies have demonstrated that Cutaneous Lymphocyte Antigen (CLA), recognized by mAb HECA-452 (Cat. no. 555946), may be a ligand for CD62E.

940404 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940404 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940404" on CiteAb

개발 참고 자료 (7)

  1. Borges E, Pendl G, Eytner R, Steegmaier M, Zollner O, Vestweber D. The binding of T cell-expressed P-selectin glycoprotein ligand-1 to E- and P-selectin is differentially regulated. J Biol Chem. 1997; 272(45):28786-28792. (Biology). 참조 보기
  2. Bosse R, Vestweber D. Only simultaneous blocking of the L- and P-selectin completely inhibits neutrophil migration into mouse peritoneum. Eur J Immunol. 1994; 24(12):3019-3024. (Immunogen: Blocking, ELISA, Immunoprecipitation). 참조 보기
  3. Eppihimer MJ, Wolitzky B, Anderson DC, Labow MA, Granger DN. Heterogeneity of expression of E- and P-selectins in vivo. Circ Res. 1996; 79(3):560-569. (Biology: Blocking). 참조 보기
  4. Ley K, Bullard DC, Arbones ML, et al. Sequential contribution of L- and P-selectin to leukocyte rolling in vivo. J Exp Med. 1995; 181(2):669-675. (Biology). 참조 보기
  5. Pendl GG, Robert C, Steinert M, et al. Immature mouse dendritic cells enter inflamed tissue, a process that requires E- and P-selectin, but not P-selectin glycoprotein ligand 1. Blood. 2002; 99(3):946-956. (Biology). 참조 보기
  6. Ramos CL, Kunkel EJ, Lawrence MB, et al. Differential effect of E-selectin antibodies on neutrophil rolling and recruitment to inflammatory sites. Blood. 1997; 89(8):3009-3018. (Immunogen: Blocking). 참조 보기
  7. Weller A, Isenmann S, Vestweber D. Cloning of the mouse endothelial selectins. Expression of both E- and P-selectin is inducible by tumor necrosis factor alpha. J Biol Chem. 1992; 267(21):15176-15183. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940404 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.