Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD47

BD™ AbSeq Oligo Rat Anti-Mouse CD47

Clone miap301 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Cd47; IAP; Integrin-associated protein; Itgp
16423
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGAGAACGTAAATATAGTGGAGTAGCGGAAGATGGT
AMM2224
Not reported
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940446 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
miap301

The miap301 monoclonal antibody specifically binds to the extracellular domain of CD47, also known as Integrin-Associated Protein (IAP). CD47 is a 50-kDa plasma membrane protein with an extracellular immunoglobulin variable region-like domain, a multiple membrane-spanning segment, and a short C-terminal cytoplasmic tail. IAP is often physically associated with β3 integrins, and it may act as a transducer element in activation mediated by these integrins. CD47 is expressed by a wide variety of cell types, including some cells lacking integrins, such as erythrocytes. The cytoplasmic tail region is expressed as alternatively spliced forms, which are differentially expressed in diverse tissues, suggesting that IAP may have distinct functions in various tissues. CD47 and its ligand, CD172a, are proposed to mediate bi-directional signaling to modify neural synaptic activity and regulate the phagocytic activities of macrophages.

940446 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940446 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940446" on CiteAb

개발 참고 자료 (7)

  1. Gresham HD, Dale BM, Potter JW, et al. Negative regulation of phagocytosis in murine macrophages by the Src kinase family member, Fgr. J Exp Med. 2000; 191(3):515-528. (Biology). 참조 보기
  2. Jiang P, Lagenaur CF, Narayanan V. Integrin-associated protein is a ligand for the P84 neural adhesion molecule. J Biol Chem. 1999; 274(2):559-562. (Clone-specific: Immunofluorescence, Immunohistochemistry). 참조 보기
  3. Lindberg FP, Bullard DC, Caver TE, Gresham HD, Beaudet AL, Brown EJ. Decreased resistance to bacterial infection and granulocyte defects in IAP-deficient mice. Science. 1996; 274(5288):795-798. (Clone-specific: Western blot). 참조 보기
  4. Lindberg FP, Gresham HD, Schwarz E, Brown EJ. Molecular cloning of integrin-associated protein: an immunoglobulin family member with multiple membrane-spanning domains implicated in alpha v beta 3-dependent ligand binding. J Cell Biol. 1993; 123(2):485-496. (Biology). 참조 보기
  5. Mi ZP, Jiang P, Weng WL, Lindberg FP, Narayanan V, Lagenaur CF. Expression of a synapse-associated membrane protein, P84/SHPS-1, and its ligand, IAP/CD47, in mouse retina. J Comp Neurol. 2000; 416(3):335-344. (Clone-specific: Immunofluorescence, Immunohistochemistry). 참조 보기
  6. Oldenborg PA, Zheleznyak A, Fang YF, Lagenaur CF, Gresham HD, Lindberg FP. Role of CD47 as a marker of self on red blood cells. Science. 2000; 288(5473):2051-2054. (Biology). 참조 보기
  7. Reinhold MI, Lindberg FP, Plas D, Reynolds S, Peters MG, Brown EJ. In vivo expression of alternatively spliced forms of integrin-associated protein (CD47). J Cell Sci. 1995 November; 108(Pt 11):3419-3425. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940446 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.