Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD45RB

BD™ AbSeq Oligo Rat Anti-Mouse CD45RB

Clone 16A (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Ptprc; CD45R; CD45; LCA; Leukocyte common antigen; Ly-5; Lyt-4
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATTTGCTAGAGTATTGTCGTATTGGTGTAAGGGCG
AMM2102
Cloned Mouse TH2 cell lines
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940206 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
16A

The 16A monoclonal antibody specifically recognizes an exon B-dependent epitope of CD45 lycoprotein, which is found at high density on peripheral B cells, T cytotoxic/suppressor cells, a subset of T helper cells, and most thymocytes, and at low density on macrophages and dendritic cells. CD45RB expression appears to decrease as T lymphocytes progress from naive to memory cells. In addition, subpopulations of CD4+ T cells which express high and low levels of CD45RB have different cytokine secretion profiles and mediate distinct immunological functions. CD25+  D4+ regulatory T (Treg) lymphocytes which control intestinal inflammation and autoimmunity express low levels of  CD45RB.  CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family; its intracellular (COOH-terminal) region contains two PTP catalytic domains, and the extracellular region is highly variable due to alternative splicing of exons (designated A, B, and C, respectively) as well as differing levels of glycosylation. The CD45 isoforms detected in the mouse are cell type-, maturation-, and activation state-specific. The CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction.

940206 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940206 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940206" on CiteAb

개발 참고 자료 (3)

  1. Bottomly K, Luqman M, Greenbaum L. A monoclonal antibody to murine CD45R distinguishes CD4 T cell populations that produce different cytokines. Eur J Immunol. 1989; 19(4):617-623. (Immunogen: Cell separation, Flow cytometry, Fluorescence microscopy, Immunoprecipitation). 참조 보기
  2. Dianzani U, Luqman M, Rojo J. Molecular associations on the T cell surface correlate with immunological memory. Eur J Immunol. 1990; 20(10):2249-2257. (Clone-specific). 참조 보기
  3. Ernst DN, Weigle WO, Noonan DJ, McQuitty DN, Hobbs MV. The age-associated increase in IFN-γ synthesis by mouse CD8+ T cells correlates with shifts in the frequencies of cell subsets defined by membrane CD44, CD45RB, 3G11, and MEL-14 expression. J Immunol. 1993; 151(2):575-587. (Clone-specific: Flow cytometry). 참조 보기
940206 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.