Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD4

BD™ AbSeq Oligo Rat Anti-Mouse CD4

Clone RM4-4

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Cd4; CD4 antigen; L3T4; Ly-4; T-cell surface antigen T4/Leu-3
12504
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTAGGAGGGTGGCGAATTATTATAGTTGAGGCGTC
AMM2255
BALB/c mouse thymocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD4 Olgo AMM2255 RM4-4 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940490 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
RM4-4

The RM4-4 monoclonal antibody specifically binds to CD4 (L3T4) differentiation antigen expressed on most thymocytes, a subpopulation of mature T lymphocytes (ie, MHC class II-restricted T cells, including most T helper cells), and a subset of NK-T cells of all mouse strains tested. CD4 has also been detected at low density on pluripotent hematopoietic stem cells, bone marrow myeloid and B-lymphocyte precursors, intrathymic lymphoid precursors, and a subset of splenic dendritic cells. CD4 is expressed on the plasma membrane of mouse egg cells and is involved in adhesion of the egg to MHC class II-bearing sperm. CD4 is an antigen coreceptor on the T-cell surface which interacts with MHC class II molecules on antigen-presenting cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck. Purified RM4-4 mAb does not block binding of the CD4-specific monoclonal antibodies, GK1.5, H129.19, or RM4-5, to T cells.

940490 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940490 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (12)

  1. Allman D, Li J, Hardy RR. Commitment to the B lymphoid lineage occurs before DH-JH recombination. J Exp Med. 1999; 189(4):735-740. (Biology). 참조 보기
  2. Bendelac A. Mouse NK1+ T cells. Curr Opin Immunol. 1995; 7(3):367-374. (Biology: Flow cytometry). 참조 보기
  3. Bierer BE, Sleckman BP, Ratnofsky SE, Burakoff SJ. The biologic roles of CD2, CD4, and CD8 in T-cell activation. Annu Rev Immunol. 1989; 7:579-599. (Biology). 참조 보기
  4. Frederickson GG, Basch RS. L3T4 antigen expression by hemopoietic precursor cells. J Exp Med. 1989; 169(4):1473-1478. (Biology). 참조 보기
  5. Godfrey DI, Kennedy J, Mombaerts P, Tonegawa S, Zlotnik A. Onset of TCR-β gene rearrangement and role of TCR-β expression during CD3-CD4-CD8- thymocyte differentiation. J Immunol. 1994; 152(10):4783-4792. (Biology). 참조 보기
  6. Guo MW, Watanabe T, Mori E, Mori T. Molecular structure and function of CD4 on murine egg plasma membrane. Zygote. 1995; 3(1):65-73. (Biology). 참조 보기
  7. Janeway CA Jr. The T cell receptor as a multicomponent signalling machine: CD4/CD8 coreceptors and CD45 in T cell activation. Annu Rev Immunol. 1992; 10:645-674. (Biology). 참조 보기
  8. Martin P, del Hoyo GM, Anjuere F, et al. Concept of lymphoid versus myeloid dendritic cell lineages revisited: both CD8alpha(-) and CD8alpha(+) dendritic cells are generated from CD4(low) lymphoid-committed precursors. Blood. 2000; 96(7):2511-2519. (Biology). 참조 보기
  9. Takeuchi Y, Horiuchi T, Hamamura K, Sugimoto T, Yagita H, Okumura K. Role of CD4 molecule in intrathymic T-cell development. Immunology. 1991; 74(2):183-190. (Immunogen: Functional assay, Inhibition). 참조 보기
  10. Wineman JP, Gilmore GL, Gritzmacher C, Torbett BE, Muller-Sieburg CE. CD4 is expressed on murine pluripotent hematopoietic stem cells. Blood. 1992; 180(7):1717-1724. (Biology). 참조 보기
  11. Wu L, Antica M, Johnson GR, Scollay R, Shortman K. Developmental potential of the earliest precursor cells from the adult mouse thymus. J Exp Med. 1991; 174(6):1617-1627. (Biology). 참조 보기
  12. Wu L, Scollay R, Egerton M, Pearse M, Spangrude GJ, Shortman K. CD4 expressed on earliest T-lineage precursor cells in the adult murine thymus. Nature. 1991; 349(6304):71-74. (Biology). 참조 보기
모두 보기 (12) 간단히 보기
940490 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.