Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD31

BD™ AbSeq Oligo Rat Anti-Mouse CD31

Clone 390

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Platelet endothelial cell adhesion molecule; Pecam1; PECAM-1; Pecam-1
18613
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCGGAGGCGTTGAAGATCGTTGAGTAAGAGTAGTGT
AMM2127
C3H/HeJ mouse hematopoietic progenitor cell line 32D
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD31 Olgo AMM2127 390 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940339 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
390

The 390 monoclonal antibody specifically binds to CD31, also known as PECAM-1 (platelet endothelial cell adhesion molecule). CD31 is a ~130 kDa integral membrane glycoprotein, a member of the immunoglobulin superfamily, that mediates homophilic and heterophilic cell-cell adhesion. CD31 is expressed constitutively on the surface of adult and embryonic endothelial cells and is weakly expressed on many peripheral leukocytes and platelets. It has also been detected on bone marrow-derived hematopoietic stem cells and embryonic stem cells. CD31 is involved in the transendothelial emigration of neutrophils, and neutrophil PECAM-1 appears to be down-regulated after extravasation into inflamed tissues. Multiple alternatively spliced isoforms are detected during early post-implantation embryonic development; this alternative splicing is involved in regulation of ligand specificity. CD38 and vitronectin receptor (αvβ3 integrin, CD51/CD61) are proposed to be ligands for CD31. CD31-mediated endothelial cell-cell interactions are involved in angiogenesis. The 390 mAb inhibits a variety of in vitro and in vivo functions mediated by CD31.

940339 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940339 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (13)

  1. Baldwin HS, Shen HM, Yan HC, et al. Platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31): alternatively spliced, functionally distinct isoforms expressed during mammalian cardiovascular development. Development. 1994; 120(9):2539-2953. (Immunogen: Bioassay, Immunoprecipitation). 참조 보기
  2. Buck CA, Baldwin HS, DeLisser H, et al. Cell adhesion receptors and early mammalian heart development: an overview. C R Acad Sci III. 1993; 316(9):849-859. (Biology). 참조 보기
  3. Buck CA, Edelman JM, Buck CE, Kennedy G, Baldwin HS. Expression patterns of adhesion receptors in the developing mouse lung: functional implications. Cell Adhes Commun. 1996; 4(2):69-87. (Biology). 참조 보기
  4. Christofidou-Solomidou M, Nakada MT, Williams J, Muller WA, DeLisser HM. Neutrophil platelet endothelial cell adhesion molecule-1 participates in neutrophil recruitment at inflammatory sites and is down-regulated after leukocyte extravasation. J Immunol. 1997; 158(10):4872-4878. (Biology). 참조 보기
  5. DeLisser HM, Christofidou-Solomidou M, Strieter RM, et al. Involvement of endothelial PECAM-1/CD31 in angiogenesis. Am J Pathol. 1997; 151(3):671-677. (Clone-specific: Blocking). 참조 보기
  6. DeLisser HM, Newman PJ, Albelda SM. Molecular and functional aspects of PECAM-1/CD31. Immunol Today. 1994; 15(10):490-495. (Biology). 참조 보기
  7. Duncan GS, Andrew DP, Takimoto H, et al. Genetic evidence for functional redundancy of Platelet/Endothelial cell adhesion molecule-1 (PECAM-1): CD31-deficient mice reveal PECAM-1-dependent and PECAM-1-independent functions. J Immunol. 1999; 162(5):3022-3030. (Biology). 참조 보기
  8. Famiglietti J, Sun J, DeLisser HM, Albelda SM. Tyrosine residue in exon 14 of the cytoplasmic domain of platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31) regulates ligand binding specificity. J Cell Biol. 1997; 138(6):1425-1435. (Biology). 참조 보기
  9. Horenstein AL, Stockinger H, Imhof BA, Malavasi F. CD38 binding to human myeloid cells is mediated by mouse and human CD31. Biochem J. 1998; 330(3):1129-1135. (Biology). 참조 보기
  10. Iguchi A, Okuyama R, Koguma M, Obinata M, Yanai N. Selective stimulation of granulopoiesis in vitro by established bone marrow stromal cells. Cell Struct Funct. 1997; 22(3):357-364. (Clone-specific: Blocking). 참조 보기
  11. Ling V, Luxenberg D, Wang J, et al. Structural identification of the hematopoietic progenitor antigen ER-MP12 as the vascular endothelial adhesion molecule PECAM-1 (CD31). Eur J Immunol. 1997; 27(2):509-514. (Biology). 참조 보기
  12. Piali L, Hammel P, Uherek C, et al. CD31/PECAM-1 is a ligand for alpha v beta 3 integrin involved in adhesion of leukocytes to endothelium. J Cell Biol. 1995; 130(2):451-460. (Biology). 참조 보기
  13. Rosenblum WI, Murata S, Nelson GH, Werner PK, Ranken R, Harmon RC. Anti-CD31 delays platelet adhesion/aggregation at sites of endothelial injury in mouse cerebral arterioles. Am J Pathol. 1994; 145(1):33-36. (Clone-specific: Blocking). 참조 보기
모두 보기 (13) 간단히 보기
940339 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.