Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD279 (PD-1)

BD™ AbSeq Oligo Rat Anti-Mouse CD279 (PD-1)

Clone RMP1-30 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
PD-1; mPD-1; Pdc1; Pdcd1; Ly101
18566
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTCGTATGATGTGAGTTGCGGTATTATTCCAGTTT
AMM2138
Mouse PD-1 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940343 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
RMP1-30

The RMP1-30 monoclonal antibody specifically recognizes CD279 which is also known as PD-1 (programmed death-1). CD279 (PD-1) is a ~55 kDa type I transmembrane glycoprotein that is encoded by Pdcd1 which belongs to the CD28/CTLA-4 family within the Ig superfamily. CD279 (PD-1) is comprised of an extracellular region with an IgV-like domain and an intracellular region with an immunoreceptor tyrosine-based inhibitory motif (ITIM) and an immunoreceptor tyrosine-based switch motif (ITSM) that are associated with inhibitory signaling functions. CD279 (PD-1) is transiently expressed on CD4-CD8- thymocytes and developing B lymphocytes at the pro-B-cell stage. It is also expressed on activated myeloid cells, B cells, and T cells including exhausted T cells found in mice during chronic viral infections or cancer. This co-inhibitory receptor reportedly functions in negative regulation of immune responses and thus helps guard against autoimmunity and preserves peripheral tolerance. CD273 (also known as PD-L2 or B7-DC) and CD274 (PD-L1 or B7-H1) are members of the B7 family within the Ig superfamily that serve as ligands for CD279 (PD-1). The RMP1-30 antibody reportedly does not block the binding of CD279 (PD-1) to these ligands.

940343 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940343 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940343" on CiteAb

개발 참고 자료 (7)

  1. Agata Y, Kawasaki A, Nishimura H, et al. Expression of the PD-1 antigen on the surface of stimulated mouse T and B lymphocytes. Int Immunol. 1996 May; 8(5):765-772. (Biology). 참조 보기
  2. Gupta PK, Godec J, Wolski D, et al. CD39 Expression Identifies Terminally Exhausted CD8+ T Cells.. PLoS Pathog. 2015; 11(10):e1005177. (Clone-specific: Flow cytometry). 참조 보기
  3. Kasagi S, Kawano S, Okazaki T, et al. Anti-programmed cell death 1 antibody reduces CD4+PD-1+ T cells and relieves the lupus-like nephritis of NZB/W F1 mice.. J Immunol. 2010; 184(5):2337-47. (Clone-specific: Flow cytometry). 참조 보기
  4. Liu X, Gibbons RM, Harrington SM, et al. Endogenous tumor-reactive CD8+ T cells are differentiated effector cells expressing high levels of CD11a and PD-1 but are unable to control tumor growth.. Oncoimmunology. 2013; 2(6):e23972. (Clone-specific: Flow cytometry). 참조 보기
  5. Matsumoto K, Inoue H, Nakano T, et al. B7-DC regulates asthmatic response by an IFN-gamma-dependent mechanism.. J Immunol. 2004; 172(4):2530-41. (Immunogen). 참조 보기
  6. Nishimura H, Agata Y, Kawasaki A, et al. Developmentally regulated expression of the PD-1 protein on the surface of double-negative (CD4-CD8-) thymocytes. Int Immunol. 1996 May; 8(5):773-780. (Biology). 참조 보기
  7. Tsushima F, Iwai H, Otsuki N, et al. Preferential contribution of B7-H1 to programmed death-1-mediated regulation of hapten-specific allergic inflammatory responses. Eur J Immunol. 2003; 33(10):2773-2782. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940343 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.