Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD273

BD™ AbSeq Oligo Rat Anti-Mouse CD273

Clone TY25 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Pdcd1lg2; B7dc; B7-DC; PD-1 ligand 2; PD-L2; Btdc
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCGTTGAAGGATATCGTGTAGACTGTCGTTAATGCC
AMM2076
Mouse B7-DC
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940180 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
TY25

The TY25 monoclonal antibody specifically binds to CD273, also known as B7-DC or PD-L2. CD273 is a 42-kDa type I membrane glycoprotein encoded by the Pdcd1lg2 gene of the B7 family of the Ig superfamily. Pdcd1lg2 mRNA is expressed selectively in dendritic cells (DC), liver, and a few transformed cell lines (hepatic, neuroblastoma, and myeloid), but not in lymphoid tissues or macrophages. The protein has not been detected on resting peripheral T and B lymphocytes, macrophages, or DC, but it is upregulated upon activation of T cells, macrophages, and DC by a variety of stimulatory factors. B7-DC's receptor, PD-1, contains an ITIM (Immunoreceptor Tyrosine-based Inhibitory Motif) on its intracytoplasmic region and is expressed on activated B and T lymphocytes, suggesting that B7-DC-PD-1 interaction may be involved in the negative regulation of immune responses. The second PD-1 ligand, B7-H1 (PD-L1), is also a member of the B7 family of the Ig superfamily.  B7-DC may also participate in positive immunoregulation, or costimulation of T cells, through an additional receptor, which is not PD-1 and distinct from the alternate receptor for B7-H1. Moreover, B7-DC is the first B7 ligand that has been found to participate in bi-directional communication; ligation of B7-DC on DC stimulates those DC. The TY25 antibody blocks the binding of B7-DC to PD-1, but not to its alternate ligand.

940180 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940180 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940180" on CiteAb

개발 참고 자료 (11)

  1. Ansari MJ, Salama AD, Chitnis T, et al. The programmed death-1 (PD-1) pathway regulates autoimmune diabetes in nonobese diabetic (NOD) mice. J Exp Med. 2003 July; 198(1):63-69. (Clone-specific: Blocking, Flow cytometry, Immunohistochemistry). 참조 보기
  2. Carreno BM, Collins M. The B7 family of ligands and its receptors: New pathways for costimulation and inhibition of immune responses. Annu Rev Immunol. 2002; 20:29-53. (Biology). 참조 보기
  3. Latchman Y, Wood CR, Chernova T, et al. PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2001; 2(3):261-268. (Biology). 참조 보기
  4. Liu X, Gao JX, Wen J, et al. B7DC/PDL2 promotes tumor immunity by a PD-1-independent mechanism. J Exp Med. 2003; 197:1721-1730. (Clone-specific: Blocking, Flow cytometry). 참조 보기
  5. Nguyen LT, Radhakrishnan S, Ciric B, et al. Cross-linking the B7 family molecule B7-DC directly activates immune functions of dendritic cells. J Exp Med. 2002; 196:1393-1398. (Biology). 참조 보기
  6. Salama AD, Chitnis T, Imitola J, et al. Critical role of the programmed death-1 (PD-1) pathway in regulation of experimental autoimmune encephalomyelitis. J Exp Med. 2003 July; 198(1):71-78. (Biology). 참조 보기
  7. Shin T, Kennedy G, Gorski K et al. Cooperative B7-1/2 (CD80/CD86) and B7-DC costimulation of CD4+ T cells independent of the PD-1 receptor. J Exp Med. 2003; 198:31-38. (Biology). 참조 보기
  8. Tseng S-Y, Otsuji M, Gorski K, et al. B7-DC, a new dendritic cell molecule with potent costimulatory properties for T cells. J Exp Med. 2001; 193:839-846. (Biology). 참조 보기
  9. Tsushima F, Iwai H, Otsuki N, et al. Preferential contribution of B7-H1 to programmed death-1-mediated regulation of hapten-specific allergic inflammatory responses. Eur J Immunol. 2003; 33(10):2773-2782. (Clone-specific: Blocking, Immunohistochemistry, In vivo exacerbation). 참조 보기
  10. Wang S, Bajorath J, Flies DB, Dong H, Honjo T, Chen L. Molecular modeling and functional mapping of B7-H1 and B7-DC uncouple costimulatory function from PD-1 interaction. J Exp Med. 2003; 197:1083-1091. (Biology). 참조 보기
  11. Yamazaki T, Akiba H, Iwai H, et al. Expression of programmed death 1 ligands by murine T cells and APC. J Immunol. 2002; 169(10):5538-5545. (Immunogen: Flow cytometry, Immunoprecipitation, Western blot). 참조 보기
모두 보기 (11) 간단히 보기
940180 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.