Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD24

BD™ AbSeq Oligo Rat Anti-Mouse CD24

Clone M1/69 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CD24a; HSA; Heat Stable Antigen; Ly-52; Nectadrin; R13-Ag
12484
2 µl
Rat DA, also known as DA/HA IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTATATACGTAGTCGGAATGTTGAGTCGGGCGGTGG
AMM2040
C57BL/10 Mouse Splenic T Lymphocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940144 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
M1/69

The M1/69 monoclonal antibody specifically binds to CD24 (Heat-Stable Antigen, HSA or HsAg), a variably glycosylated, glycosyl-phosphatidylinositol-anchored membrane protein expressed on erythrocytes, granulocytes, monocytes, lymphocytes, and neurons. Hematopoietic stem cells of the embryonic yolk sac and fetal liver express CD24. Levels of expression of CD24 vary during differentiation of the T and B cell lineages. In  the bone marrow, hematopoietic progenitors acquire CD24 expression upon commitment to the B-lymphocyte lineage. Immature B cells in the bone marrow express low CD24 levels whereas peripheral B lymphocytes express intermediate to high levels of CD24. The level of CD24 expression has been reported to rise upon activation of splenic B cells with LPS, but not with CD154 (CD40 Ligand). The majority of thymocytes express high levels of CD24, while most mature thymic and peripheral T lymphocytes do not express CD24. In contrast, TCR-bearing thymocytes which emigrate to the spleen are CD24+. Dendritic cells of the thymus, spleen, liver, and epidermal Langerhans cells have also been reported to express CD24. CD24 is not expressed by NK cells, as determined by staining with J11d mAb (Cat. No. 553146). CD24 is involved in the costimulation of CD4+ T cells by B cells, it is a "co-inducer" of in vitro thymocyte maturation, and it is a ligand of CD62P (P-selectin). While the monoclonal antibodies 30-F1, M1/69, and J11d all react with CD24, they show subtle differences in the level of staining of different lymphocyte populations. When possible, investigators should continue to use the same monoclonal anti-CD24 antibody as used in previous studies.

940144 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940144 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940144" on CiteAb

개발 참고 자료 (11)

  1. Allman DM, Ferguson SE, Cancro MP. Peripheral B cell maturation. I. Immature peripheral B cells in adults are heat-stable antigenhi and exhibit unique signaling characteristics. J Immunol. 1992; 149(8):2533-2540. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). 참조 보기
  2. Allman DM, Ferguson SE, Lentz VM, Cancro MP. Peripheral B cell maturation. II. Heat-stable antigen(hi) splenic B cells are an immature developmental intermediate in the production of long-lived marrow-derived B cells. J Immunol. 1993; 151(9):4431-4444. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). 참조 보기
  3. Alterman LA, Crispe IN, Kinnon C. Characterization of the murine heat-stable antigen: an hematolymphoid differentiation antigen defined by the J11d, M1/69 and B2A2 antibodies. Eur J Immunol. 1990; 20(7):1597-1602. (Clone-specific: Flow cytometry). 참조 보기
  4. Cibotti R, Punt JA, Dash KS, Sharrow SO, Singer A. Surface molecules that drive T cell development in vitro in the absence of thymic epithelium and in the absence of lineage-specific signals. Immunity. 1997; 6(3):245-255. (Clone-specific: (Co)-stimulation, Flow cytometry). 참조 보기
  5. Crispe IN, Bevan MJ. Expression and functional significance of the J11d marker on mouse thymocytes. J Immunol. 1987 April; 138(7):2013-2018. (Clone-specific: Flow cytometry). 참조 보기
  6. Milstein C, Galfre G, Secher DS, Springer T. Monoclonal antibodies and cell surface antigens. Ciba Found Symp. 1979; 66:251-276. (Clone-specific: Flow cytometry). 참조 보기
  7. Springer T, Galfre G, Secher D, Milstein C. Monoclonal xenogeneic antibodies to mouse leukocyte antigens: identification of macrophage-specific and other differentiation antigens. Curr Top Microbiol Immunol. 1978; 81:45-50. (Immunogen: Radioimmunoassay). 참조 보기
  8. Springer T, Galfre G, Secher DS, Milstein C. Monoclonal xenogeneic antibodies to murine cell surface antigens: identification of novel leukocyte differentiation antigens. Eur J Immunol. 1978; 8(8):539-551. (Immunogen: Blocking, Radioimmunoassay). 참조 보기
  9. Stall AM, Wells SM. FACS analysis of murine B-cell populations. In: Herzenberg LA, Weir DM, Blackwell C, ed. Weir's Handbook of Experimental Immunology. Blackwell Science Publishers; 1997:63.1-63.17.
  10. Veillette A, Zuniga-Pflucker JC, Bolen JB, Kruisbeek AM. Engagement of CD4 and CD8 expressed on immature thymocytes induces activation of intracellular tyrosine phosphorylation pathways. J Exp Med. 1989; 170(5):1671-1680. (Clone-specific: Cell separation, Cytotoxicity). 참조 보기
  11. Wenger RH, Rochelle JM, Seldin MF, Kohler G, Nielsen PJ. The heat stable antigen (mouse CD24) gene is differentially regulated but has a housekeeping promoter. J Biol Chem. 1993; 268(31):23345-23352. (Biology). 참조 보기
모두 보기 (11) 간단히 보기
940144 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.