Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD18

BD™ AbSeq Oligo Rat Anti-Mouse CD18

Clone C71/16

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Itgb2; Integrin beta-2; ITB2; LAD; LCAMB; LFA-1/Mac-1/p150,95 subunit beta
16414
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGGAGGTTCGGTGCTTATCATGTTACTTACGTGTG
AMM2242
Cell membrane glycoproteins from mouse T-cell lymphoma BW5147
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD18 Olgo AMM2242 C71/16 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940480 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
C71/16

The C71/16 monoclonal antibody specifically binds to mouse CD18 which is also known as the common β2 chain of LFA-1 (CD11a/CD18, αLβ2 integrin), Mac-1 (CD11b/CD18, αMβ2 integrin), and gp150, 95 (CD11c/CD18, αxβ2 integrin).  CD18 is a type I transmembrane glycoprotein. Expression of CD18 is limited to leukocytes, where it is widely distributed in consort with the three integrin α chains (CD11a, CD11b, and CD11c).  Among splenocytes, NK cells have the highest density of CD18, and T lymphocytes express a higher density than the remaining cells. The β2 integrins are important mediators of leukocyte-endothelium interactions.

940480 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940480 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (3)

  1. Springer TA. Adhesion receptors of the immune system. Nature. 1990; 346(6283):425-434. (Biology). 참조 보기
  2. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994; 76(2):301-314. (Biology). 참조 보기
  3. Trowbridge IS, Omary MB. Molecular complexity of leukocyte surface glycoproteins related to the macrophage differentiation antigen Mac-1. J Exp Med. 1981; 154(5):1517-1524. (Immunogen: Flow cytometry, Immunoprecipitation). 참조 보기
940480 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.