Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD179b

BD™ AbSeq Oligo Rat Anti-Mouse CD179b

Clone LM34 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
λ5; Lambda 5; VpreB1; Vpreb-2; Immunoglobulin omega chain; Ig omega
22363
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGAATGGTTGGTCGTTGATCGTATGGAGAAGTAGG
AMM2182
Purified soluble complex of recombinant µ IgH, λ5, and V[preB]
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940424 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
LM34

The pre-B cell receptor (pre-BCR) expressed during the early stages of B lymphocyte development is a heterodimer of immunoglobulin heavy chain (IgH) with surrogate light chain, which is an Ig-light-chain-like molecule composed of the non-covalently linked CD179b (λ5) and CD179a (VpreB) proteins. The pre-BCR is believed to control IgH repertoire selection and proliferation of differentiating B lymphocytes. The LM34 antibody reacts with λ5 and surrogate light chain, but not VpreB alone, in transfected X63-Ag8.653 cells. It detects surrogate light chain on pro-B and pre-B cell lines, in the presence or absence of IgH, but not on IgM-positive B lymphocytes. It also detects surrogate light chain or λ5 on the surface and in the cytoplasm of pro-B or pre-B cells from the bone marrow of normal or RAG2-deficient mice. It has been noted that the (CD45R/B220) cell-surface expression of surrogate light chain is upregulated after a one-hour incubation of bone-marrow leukocytes in tissue culture medium at 37°C. At the earliest stages of B lymphopoiesis, before IgH is available, the surrogate light chain associates with a complex of glycoproteins, including a nonclassical cadherin, which could be involved in selective adhesion events during B-lymphocyte development.  After immunization, cell-surface λ5 is detected on a subset of splenic Ig light chain-positive germinal-center B lymphocytes.

940424 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940424 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940424" on CiteAb

개발 참고 자료 (9)

  1. Karasuyama H, Rolink A, Melchers F. A complex of glycoproteins is associated with VpreB/lambda 5 surrogate light chain on the surface of mu heavy chain-negative early precursor B cell lines. J Exp Med. 1993; 178(2):469-478. (Immunogen). 참조 보기
  2. Karasuyama H, Rolink A, Shinkai Y, Young F, Alt FW, Melchers F. The expression of Vpre-B/lambda 5 surrogate light chain in early bone marrow precursor B cells of normal and B cell-deficient mutant mice. Cell. 1994 April; 77(1):133-143. (Biology). 참조 보기
  3. Martensson IL, Ceredig R. Review article: role of the surrogate light chain and the pre-B-cell receptor in mouse B-cell development. Immunology. 2000; 101(4):435-441. (Biology). 참조 보기
  4. Meffre E, Papavasiliou F, Cohen P, et al. Antigen receptor engagement turns off the V(D)J recombination machinery in human tonsil B cells. J Exp Med. 1998; 188(4):765-772. (Biology). 참조 보기
  5. Melchers F, ten Boekel E, Seidl T, et al. Repertoire selection by pre-B-cell receptors and B-cell receptors, and genetic control of B-cell development from immature to mature B cells. Immunol Rev. 2000; 175:33-46. (Biology). 참조 보기
  6. Ohnishi K, Shimizu T, Karasuyama H, Melchers F. The identification of a nonclassical cadherin expressed during B cell development and its interaction with surrogate light chain. J Biol Chem. 2000; 275(40):31134-31144. (Biology). 참조 보기
  7. Rolink A, Grawunder U, Winkler TH, Karasuyama H, Melchers F. IL-2 receptor alpha chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int Immunol. 1994; 6(8):1257-1264. (Biology). 참조 보기
  8. Shimizu T, Mundt C, Licence S, Melchers F, Martensson IL. VpreB1/VpreB2/lambda 5 triple-deficient mice show impaired B cell development but functional allelic exclusion of the IgH locus. J Immunol. 2002; 168(12):6286-6293. (Biology). 참조 보기
  9. Winkler TH, Rolink A, Melchers F, Karasuyama H. Precursor B cells of mouse bone marrow express two different complexes with the surrogate light chain on the surface. Eur J Immunol. 1995; 25(2):446-450. (Biology). 참조 보기
모두 보기 (9) 간단히 보기
940424 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.