Skip to main content Skip to navigation
Oligo Rat Anti-Human CX3CR1

BD™ AbSeq Oligo Rat Anti-Human CX3CR1

Clone 2A9-1

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CCRL1; CMKBRL1; CMKDR1; GPR13; GPRV28; V28; Fractalkine Receptor
1524
2 µl
Rat IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGGTTCACGAGGTTTAAAGCGGTAGTATAGGATGCC
AHS0125
Human CX3CR1 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Hu CX3CR1 Olgo AHS0125 2A9-1 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940216 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
2A9-1

The 2A9-1 monoclonal antibody specifically binds to human CX3CR1, which is also known as chemokine (C-C) receptor-like 1 (CCRL1), Beta chemokine receptor-like 1 (CMK-BRL-1), G protein-coupled receptor 13 (GPR13), or GPRV28 (V28). CX3CR1 is a seven transmembrane G protein coupled receptor that is expressed by NK cells, T cells, and monocytes. The cellular expression of CX3CR1 is correlated with high levels of intracellular perforin and granzyme B. CX3CR1 serves as a receptor for fractalkine (CX3CL1). Fractalkine is a transmembrane chemokine of the CX3C family that is expressed on activated endothelial cells, neurons, and astrocytes. Interaction of CX3CR1 with fractalkine initiates cellular adhesive and chemotactic responses.

940216 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940216 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Kobayashi T, Okamoto S, Iwakami Y, et al. Exclusive increase of CX3CR1+CD28-CD4+ T cells in inflammatory bowel disease and their recruitment as intraepithelial lymphocytes.. Inflamm Bowel Dis. 2007; 13(7):837-46. (Biology). 참조 보기
  2. Kondo Y, Kimura O, Tanaka Y, et al. Differential Expression of CX3CL1 in Hepatitis B Virus-Replicating Hepatoma Cells Can Affect the Migration Activity of CX3CR1+ Immune Cells.. J Virol. 2015; 89(14):7016-27. (Biology). 참조 보기
  3. Nanki T, Imai T, Nagasaka K, et al. Migration of CX3CR1-positive T cells producing type 1 cytokines and cytotoxic molecules into the synovium of patients with rheumatoid arthritis.. Arthritis Rheum. 2002; 46(11):2878-83. (Clone-specific: Flow cytometry). 참조 보기
  4. Nishimura M, Umehara H, Nakayama T, et al. Dual functions of fractalkine/CX3C ligand 1 in trafficking of perforin+/granzyme B+ cytotoxic effector lymphocytes that are defined by CX3CR1 expression.. J Immunol. 2002; 168(12):6173-80. (Immunogen: Flow cytometry). 참조 보기
  5. Siwetz M, Sundl M, Kolb D, et al. Placental fractalkine mediates adhesion of THP-1 monocytes to villous trophoblast.. Histochem Cell Biol. 2015; 143(6):565-74. (Biology). 참조 보기
940216 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.