Skip to main content Skip to navigation
Oligo Rat Anti-Human CD115 (CSF-1R)

BD™ AbSeq Oligo Rat Anti-Human CD115 (CSF-1R)

Clone 9-4D2-1E4 (also known as 9-4D2)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CSF-1R; CSF1R; C-FMS; FMS; FIM2; M-CSF-R
1436
2 µl
Rat IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGGTGGCGGCGAATTTGGTTACGACATATAGGGTT
AHS0136
Human CD115 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Hu CD115 Olgo AHS0136 9-4D2-1E4 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940225 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
9-4D2-1E4

The 9-4D2-1E4 monoclonal antibody specifically binds to CD115 which is also known as Colony stimulating factor 1 receptor (CSF-1R) or Macrophage colony-stimulating factor 1 receptor (M-CSFR). This type I transmembrane glycoprotein is a receptor tyrosine kinase (RTK) that belongs to the Ig superfamily. It is expressed on a variety of cells including those committed to the mononuclear phagocyte lineage, such as, monocytes, macrophages, and osteoclasts. CSF-1 binds to and signals through CSF-1R homodimers which undergo tyrosine autophosphorylation and transduce downstream signaling pathways resulting in cytoskeletal reorganization and gene expression. CSF-1R activation stimulates the proliferation, differentiation, and survival of cells within the mononuclear phagocyte system.  Acting through CD115, CSF-1 induces macrophage spreading and motility, and in combination with RANKL, CSF-1 drives the differentiation of mononuclear phagocytes to become osteoclasts. Interleukin-34 (IL-34) is another ligand for CD115 that can induce similar, as well as, some different biological responses by CD115-positive target cells.

940225 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940225 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Ashmun RA, Look AT, Roberts WM, et al. Monoclonal antibodies to the human CSF-1 receptor (c-fms proto-oncogene product) detect epitopes on normal mononuclear phagocytes and on human myeloid leukemic blast cells. Blood. 1989; 73(3):827-837. (Immunogen: Flow cytometry, Immunoprecipitation). 참조 보기
  2. Ashmun RA, Look AT, Roussel MF, Sherr CJ. CD115 (CSF-1 receptor) cluster workshop report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:988-989.
  3. Li W, Stanley ER. Role of dimerization and modification of the CSF-1 receptor in its activation and internalization during the CSF-1 response. EMBO J. 1991; 10(2):277-288. (Biology). 참조 보기
  4. Lin H, Lee E, Hestir K, et al. Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science. 2008; 320(5877):807-811. (Biology). 참조 보기
  5. Sherr CJ, Ashmun RA, Downing JR, et al. Inhibition of colony-stimulating factor-1 activity by monoclonal antibodies to the human CSF-1 receptor. Blood. 1989; 73(7):1786-1793. (Clone-specific: Functional assay). 참조 보기
940225 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.