Skip to main content Skip to navigation
Oligo Rat Anti-Human CD104

BD™ AbSeq Oligo Rat Anti-Human CD104

Clone 439-9B (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Integrin β4 chain; Integrin beta 4; ITGB4; GP150; TSP-180
3691
2 µl
Rat F344, also known as Fischer, CDF IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGGTGAATCGTTGGCGTCTTATGAGTACTTAGGCT
AHS0141
Human CD104 Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940228 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
439-9B

The 439-9B monoclonal antibody specifically recognizes CD104, integrin β4 chain, a 205 kDa transmembrane glycoprotein, which associates with CD49f (integrin α6 chain) to form the α6/β4 (CD49f/CD104) complex. It is expressed on epithelial cells, Schwann cells, and some tumor cells. The CD49f/CD104 complex is located in the hemidesmosomes of the epidermis, suggesting its role in epidermal cell-basement membrane   adhesion. The clone 439-9B was clustered as CD104 at the fifth Human Leucocyte Differentiation Antigen International Workshop. It may be used for immunoprecipitation, immunoblotting and immunohistochemistry on frozen tissue sections.

940228 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940228 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940228" on CiteAb

개발 참고 자료 (6)

  1. Hemler ME, Crouse C, Sonnenberg A. Association of the VLA alpha 6 subunit with a novel protein. A possible alternative to the common VLA beta 1 subunit on certain cell lines. J Biol Chem. 1989; 264(11):6529-6535. (Biology). 참조 보기
  2. Jones JC, Kurpakus MA, Cooper HM, Quaranta V. A function for the integrin alpha 6 beta 4 in the hemidesmosome. Cell Regul. 1991; 2(6):427-438. (Biology). 참조 보기
  3. Mariani Costantini R, Falcioni R, Battista P, et al. Integrin (alpha 6/beta 4) expression in human lung cancer as monitored by specific monoclonal antibodies.. Cancer Res. 1990; 50(18):6107-12. (Clone-specific: Immunohistochemistry, Immunoprecipitation). 참조 보기
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Sonnenberg A, Calafat J, Janssen H, et al. Integrin alpha 6/beta 4 complex is located in hemidesmosomes, suggesting a major role in epidermal cell-basement membrane adhesion.. J Cell Biol. 1991; 113(4):907-17. (Biology). 참조 보기
  6. Tamura RN, Rozzo C, Starr L, et al. Epithelial integrin alpha 6 beta 4: complete primary structure of alpha 6 and variant forms of beta 4.. J Cell Biol. 1990; 111(4):1593-604. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940228 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.