Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse Ly-49A

BD™ AbSeq Oligo Mouse Anti-Mouse Ly-49A

Clone A1 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Ly-49a; Klra1; Killer cell lectin-like receptor subfamily A member1; Klra22
16627
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATAAGGGTAATGTTGTGCCGATGTGAAGCGAGATGC
AMM2106
Mouse C57BL/6N T lymphoma EL-4
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940322 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
A1

The A1 monoclonal antibody specifically binds to the Ly-49A[B6] alloantigen, an inhibitory receptor that is expressed on subsets of natural killer (NK) cells and NK-1.1-positive T lymphocytes (NKT cells) in C57BL/6, C57BL/10, and B10 congenic mice, on a population of memory CD8+ T lymphocytes and NK1.1+ γδ T cells in C57BL/6 mice, and on a distinct subset of B-1 cells (CD5+B220[lo]) of C57BL/6 mice. The A1 antibody has also been reported to crossreact with Ly-49ANOD, Ly-49PNOD, Ly-49P129/J, and Ly-49V129/J alloantigens. The proportion of NKT cells expressing Ly-49A is higher (2-5 fold) in thymus than in liver (immature and mature NKT cells, respectively), and there is evidence that the down regulation of Ly-49 receptor expression is necessary for normal NKT cell development to occur. Most NK cells express a single allele of Ly-49A, although occasionally they may express more than one allele. The Ly-49 family of NK-cell receptors, members of the C-type lectin superfamily, are disulfide-linked type-II transmembrane protein homodimers with extracellular carbohydrate-recognition domains (CRD) that bind to MHC class I alloantigens. The A1 antibody is specific for the Ly-49A[B6] CRD. The Ly-49 family members are expressed independently, such that an individual NK or T cell may display more than one class of Ly-49 receptor homodimers. The Ly-49A[B6] allonantigen binds to H-2D[d], H-2D[k], and H-2D[p], and the A1 antibody blocks this binding. Binding of Ly-49A[B6] to lyphoblasts expressing MHC class I antigens of the f, q, r, s, and v haplotypes has also been demonstrated. The levels of the Ly-49 inhibitory receptors are down-regulated by their ligands in vivo, and various levels of expression of a Ly-49 inhibitory receptor may affect the specificity of NK cells. In vitro studies suggest that the Ly-49A receptor mediates negative regulation of NK-cell cytolytic activity via tyrosine phosphorylation of its ITIM (Immunoreceptor Tyrosine-based Inhibitory Motif).  

940322 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940322 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940322" on CiteAb

개발 참고 자료 (31)

  1. Bendelac A. Mouse NK1+ T cells. Curr Opin Immunol. 1995; 7(3):367-374. (Clone-specific). 참조 보기
  2. Brennan J, Mahon G, Mager DL, Jefferies WA, Takei F. Recognition of class I major histocompatibility complex molecules by Ly-49: specificities and domain interactions. J Exp Med. 1996; 183(4):1553-1559. (Biology). 참조 보기
  3. Chang CS, Kane KP. Evidence for sulfate modification of H-2Dd on N-linked carbohydrate(s): possible involvement in Ly-49A interaction. J Immunol. 1998; 160(9):4367-4374. (Biology). 참조 보기
  4. Coles MC, McMahon CW, Takizawa H, Raulet DH. Memory CD8 T lymphocytes express inhibitory MHC-specific Ly49 receptors. Eur J Immunol. 2000; 30(1):236-244. (Biology). 참조 보기
  5. Daniels BF, Karlhofer FM, Seaman WE, Yokoyama WM. A natural killer cell receptor specific for a major histocompatibility complex class I molecule. J Exp Med. 1994; 180(2):687-692. (Biology). 참조 보기
  6. Guy-Grand D, Cuenod-Jabri B, Malassis-Seris M, Selz F, Vassalli P. Complexity of the mouse gut T cell immune system: identification of two distinct natural killer T cell intraepithelial lineages. Eur J Immunol. 1996; 26(9):2248-2256. (Clone-specific). 참조 보기
  7. Hanke T, Takizawa H, McMahon CW, et al. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity. 1999; 11(1):67-77. (Biology). 참조 보기
  8. Hara T, Nishimura H, Hasegawa Y, Yoshikai Y. Thymus-dependent modulation of Ly49 inhibitory receptor expression on NK1.1+gamma/delta T cells. Immunology. 2001; 102(1):24-30. (Biology). 참조 보기
  9. Held W, Kunz B. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur J Immunol. 1998; 28(8):2407-2416. (Biology). 참조 보기
  10. Hoglund P, Sundback J, Olsson-Alheim MY, et al. Host MHC class I gene control of NK-cell specificity in the mouse. Immunol Rev. 1997; 155:11-28. (Biology). 참조 보기
  11. Kane KP. Ly-49 mediates EL4 lymphoma adhesion to isolated class I major histocompatibility complex molecules. J Exp Med. 1994; 179(3):1011-1015. (Biology). 참조 보기
  12. Karlhofer FM, Ribaudo RK, Yokoyama WM. MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature. 1992; 358(6381):66-70. (Clone-specific). 참조 보기
  13. Kase A, Johansson MH, Olsson-Alheim MY, Karre K, Hoglund P. External and internal calibration of the MHC class I-specific receptor Ly49A on murine natural killer cells. J Immunol. 1998; 161(11):6133-6138. (Biology). 참조 보기
  14. Kim S, Yokoyama WM. NK cell granule exocytosis and cytokine production inhibited by Ly-49A engagement. Cell Immunol. 1998; 183(2):106-112. (Biology). 참조 보기
  15. Liu J, Yu YY, Lindahl KF, Kumar V, Bennett M. Allorecognition by murine natural killer cells: studies with bone marrow transplants and lysis of T lymphoblasts. Chem Immunol. 1996; 64:164-180. (Biology). 참조 보기
  16. Makrigiannis AP, Pau AT, Saleh A, Winkler-Pickett R, Ortaldo JR, Anderson SK. Class I MHC-binding characteristics of the 129/J Ly49 repertoire. J Immunol. 2001; 166(8):5034-5043. (Biology). 참조 보기
  17. Mason LH, Gosselin P, Anderson SK, Fogler WE, Ortaldo JR, McVicar DW. Differential tyrosine phosphorylation of inhibitory versus activating Ly-49 receptor proteins and their recruitment of SHP-1 phosphatase. J Immunol. 1997; 159(9):4187-4196. (Biology). 참조 보기
  18. Mason LH, Willette-Brown J, Anderson SK, et al. Characterization of an associated 16-kDa tyrosine phosphoprotein required for Ly-49D signal transduction. J Immunol. 1998; 160(9):4148-4152. (Biology). 참조 보기
  19. Matsumoto N, Ribaudo RK, Abastado JP, Margulies DH, Yokoyama WM. The lectin-like NK cell receptor Ly-49A recognizes a carbohydrate-independent epitope on its MHC class I ligand. Immunity. 1998; 8(2):245-254. (Biology). 참조 보기
  20. Nagasawa R, Gross J, Kanagawa O, et al. Identification of a novel T cell surface disulfide-bonded dimer distinct from the alpha/beta antigen receptor. J Immunol. 1987; 138(3):815-824. (Immunogen). 참조 보기
  21. Ochi H, Watanabe T. Negative regulation of B cell receptor-mediated signaling in B-1 cells through CD5 and Ly49 co-receptors via Lyn kinase activity. Int Immunol. 2000; 12(10):1417-1423. (Biology). 참조 보기
  22. Olsson-Alheim MY, Salcedo M, Ljunggren HG, Karre K, Sentman CL. NK cell receptor calibration: effects of MHC class I induction on killing by Ly49Ahigh and Ly49Alow NK cells. J Immunol. 1997; 159(7):3189-3194. (Biology). 참조 보기
  23. Olsson-Alheim MY, Sundback J, Karre K, Sentman CL. The MHC class I molecule H-2Dp inhibits murine NK cells via the inhibitory receptor Ly49A. J Immunol. 1999; 162(12):7010-7014. (Biology). 참조 보기
  24. Raulet DH, Held W, Correa I, Dorfman JR, Wu MF, Corral L. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I-specific Ly49 receptors. Immunol Rev. 1997; 155:41-52. (Biology). 참조 보기
  25. Robson MacDonald H, Lees RK, Held W. Developmentally regulated extinction of Ly-49 receptor expression permits maturation and selection of NK1.1+ T cells. J Exp Med. 1998; 187(12):2109-2114. (Biology). 참조 보기
  26. Silver ET, Gong DE, Chang CS, Amrani A, Santamaria P, Kane KP. Ly-49P activates NK-mediated lysis by recognizing H-2Dd. J Immunol. 2000; 165(4):1771-1781. (Biology). 참조 보기
  27. Skold M, Cardell S. Differential regulation of Ly49 expression on CD4+ and CD4-CD8- (double negative) NK1.1+ T cells. Eur J Immunol. 2000; 30(9):2488-2496. (Clone-specific). 참조 보기
  28. Sundback J, Nakamura MC, Waldenstrom M, et al. The alpha2 domain of H-2Dd restricts the allelic specificity of the murine NK cell inhibitory receptor Ly-49A. J Immunol. 1998; 160(12):5971-5978. (Biology). 참조 보기
  29. Yokoyama WM, Kehn PJ, Cohen DI, Shevach EM. Chromosomal location of the Ly-49 (A1, YE1/48) multigene family. Genetic association with the NK 1.1 antigen. J Immunol. 1990; 145(7):2353-2358. (Clone-specific). 참조 보기
  30. Yokoyama WM, Seaman WE. The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex. Annu Rev Immunol. 1993; 11:613-635. (Clone-specific). 참조 보기
  31. Yu YY, George T, Dorfman JR, Roland J, Kumar V, Bennett M. The role of Ly49A and 5E6(Ly49C) molecules in hybrid resistance mediated by murine natural killer cells against normal T cell blasts. Immunity. 1996; 4(1):67-76. (Biology). 참조 보기
모두 보기 (31) 간단히 보기
940322 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.