Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD45.1

BD™ AbSeq Oligo Mouse Anti-Mouse CD45.1

Clone A20 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Ly-5; Lyt4; CD45R; LCA; Ptprc; Protein tyrosine phosphatase receptor type C
19264
2 µl
Mouse A.SW IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATGTTCGGCGGGTATTCGTGGTTATTTATTCGGCT
AMM2029
SJL mouse thymocytes and splenocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940133 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
A20

The A20 monoclonal antibody specifically binds to CD45 (Leukocyte Common Antigen) on all leukocytes of mouse strains expressing the CD45.1 alloantigen (eg, RIII, SJL/J, STS/A, DA). This alloantigen was originally named Ly-5.2, but was later changed to Ly-5.1 to conform with the convention that the .2 alloantigen designates the C57BL/6 strain. mAb A20 has been reported not to react with leukocytes of most other mouse strains which express the CD45.2 alloantigen. CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family; its intracellular (COOH-terminal) region contains two PTP catalytic domains while the extracellular region is highly variable due to alternative splicing of exons 4, 5, and 6 (designated A, B, and C,  respectively), and differing levels of glycosylation. CD45 isoforms in the mouse are cell type-, maturation-, and activation state-specific. The CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction. The A20 antibody has been reported to inhibit some responses of B cells (from mice expressing the CD45.1 alloantigen) to antigens and LPS.

940133 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940133 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940133" on CiteAb

개발 참고 자료 (7)

  1. Johnson P, Greenbaum L, Bottomly K, Trowbridge IS. Identification of the alternatively spliced exons of murine CD45 (T200) required for reactivity with B220 and other T200-restricted antibodies. J Exp Med. 1989; 169(3):1179-1184. (Biology). 참조 보기
  2. Morse HC 3rd, Shen FW, Hammerling U. Genetic nomenclature for loci controlling mouse lymphocyte antigens. Immunogenetics. 1987; 25(2):71-78. (Biology). 참조 보기
  3. Shen FW, Tung JS, Boyse EA. Further definition of the Ly-5 system. Immunogenetics. 1986; 24(3):146-149. (Clone-specific: Immunoprecipitation). 참조 보기
  4. Shen FW. Monoclonal antibodies to mouse lymphocyte differentiation alloantigens. In: Hammerling GJ, Hammerling U, Kearney JF, ed. Monoclonal Antibodies and T-cell Hybridomas; Perspectives and Technical Advances. 1981:25-31.
  5. Suzuki K, Oida T, Hamada H, et al. Gut cryptopatches: direct evidence of extrathymic anatomical sites for intestinal T lymphopoiesis. Immunity. 2000; 13(5):691-702. (Clone-specific: Flow cytometry, Fluorescence microscopy, Immunofluorescence, Immunohistochemistry). 참조 보기
  6. Yakura H, Kawabata I, Shen FW, Katagiri M. Selective inhibition of lipopolysaccharide-induced polyclonal IgG response by monoclonal Ly-5 antibody. J Immunol. 1986; 136(8):2729-2733. (Clone-specific: Functional assay, Inhibition). 참조 보기
  7. Yakura H, Shen FW, Bourcet E, Boyse EA. On the function of Ly-5 in the regulation of antigen-driven B cell differentiation. Comparison and contrast with Lyb-2. J Exp Med. 1983; 157(4):1077-1088. (Clone-specific: Functional assay, Inhibition). 참조 보기
모두 보기 (7) 간단히 보기
940133 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.