Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD366 (TIM-3)

BD™ AbSeq Oligo Mouse Anti-Mouse CD366 (TIM-3)

Clone 5D12/TIM-3 (also known as 5D12) (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Cd366; T-cell membrane protein; Tim3; TIMD-3; Timd3; HAVcr-2; Havcr2;
2 µl
Mouse IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCATAGTAAGTTAGCGTGGTGTAGCAGCGGAAGTC
AMM2103
Mouse TIM-3 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940207 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
5D12/TIM-3

The 5D12 monoclonal antibody specifically recognizes CD366 which is also known as TIM-3 (T-cell immunoglobulin and mucin domain-containing 3) or T-cell membrane protein 3. TIM-3 is encoded by Havcr2 (hepatitis A virus cellular receptor 2). TIM-3 is a type I transmembrane glycoprotein that belongs to the human TIM family within the immunoglobulin superfamily, having one Ig-like V-type domain in its extracellular region. TIM-3 is expressed on activated monocytes, macrophages, dendritic cells, microglia, and mast cells. It is also expressed on type-1 CD4+ (Th1-like) T cells, CD8+ T cytotoxic cells, regulatory T cells (Treg), and natural killer (NK) cells. TIM-3 functions as an inhibitory receptor which helps cells maintain immunological homeostasis and self tolerance. Crosslinking of cell surface TIM-3 by Galectin-9 binding downregulates Th1-like and CD8+ T cell responses and can promote Treg or myeloid-derived suppressor cells. TIM-3 enables dendritic cells to bind phosphatidyl serine expressed by apoptotic cells and to phagocytize these cells to quell potential inflammation. TIM-3 also binds to the alarmin HMGB1 thereby preventing Toll-like receptor (TLR) by released tumor cell DNA.

940207 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940207 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940207" on CiteAb

개발 참고 자료 (4)

  1. Anderson AC, Joller N, Kuchroo VK. Lag-3, Tim-3, and TIGIT: Co-inhibitory Receptors with Specialized Functions in Immune Regulation.. Immunity. 2016; 44(5):989-1004. (Biology). 참조 보기
  2. Oikawa T1, Kamimura Y, Akiba H, et al. Preferential involvement of Tim-3 in the regulation of hepatic CD8+ T cells in murine acute graft-versus-host disease.. J Immunol. 2006; 177(7):4281-4287. (Biology). 참조 보기
  3. Phong BL, Avery L, Sumpter TL, et al. Tim-3 enhances FcεRI-proximal signaling to modulate mast cell activation.. J Exp Med. 2015; 212(13):2289-304. (Clone-specific: Flow cytometry). 참조 보기
  4. Veenstra RG, Taylor PA, Zhou Q, et al. Contrasting acute graft-versus-host disease effects of Tim-3/galectin-9 pathway blockade dependent upon the presence of donor regulatory T cells.. Blood. 2012; 120(3):682-90. (Clone-specific: Flow cytometry). 참조 보기
940207 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.