Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse CD212

BD™ AbSeq Oligo Mouse Anti-Mouse CD212

Clone 114 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Il12rb1; IL-12R-beta-1; IL-12 Receptor β1 chain
16161
2 µl
Mouse IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGAGTAGGCAATATATAGGGTTAGCACAAGAGCGG
AMM2136
IL-12Rβ1 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940496 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
114

The 114 monoclonal antibody specifically binds to mouse CD212 (the β1 subunit of IL-12Rβ1), originally termed IL-12Rβ, of the mouse IL-12 receptor complex. The IL-12Rβ1 subunit associates with a β2 subunit to form a heterodimeric IL-12 receptor complex. Each one of the IL-12R subunits exhibits low affinity for IL-12, but in combination, they bind IL-12 with high affinity. The IL-12Rβ1 subunit interacts primarily with IL-12 p40 whereas the IL-12Rβ2 binds both to IL-12 p40 and IL-12 p35.  IL-12Rβ1 is required for high affinity binding of IL-12 but IL-12Rβ2 is required for signaling. IL-12Rβ1 has more recently been described to bind IL-23, a heterodimer formed of the p40 subunit from IL-12, and p19. The cytoplasmic regions of the β1 and β2 subunits contain the box1 and box2 motifs found in other cytokine receptors such as gp130, LIFR and G-CSFR. IL-12Rβ1 are primarily expressed by activated T cells and NK cells. Experiments with IL-12Rβ1 deficient mice have shown that IL-12Rβ1 is necessary for mouse T and NK cell responsiveness to IL-12 p75. The 114 antibody was generated by immunizing IL-12Rβ1 deficient mice of (129 x BALB/c)F1 background with mouse Ba/F3 cells that were stably transfected with IL-12Rβ1.

940496 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940496 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940496" on CiteAb

개발 참고 자료 (11)

  1. Bobbitt KR, Justement LB. Regulation of MHC class II signal transduction by the B cell coreceptors CD19 and CD22. J Immunol. 2000; 165(10):5588-5596. (Biology). 참조 보기
  2. Doody GM, Justement LB, Delibrias CC. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP. Science. 1995; 269(5221):242-244. (Biology). 참조 보기
  3. Erickson LD, Tygrett LT, Bhatia SK, Grabstein KH, Waldschmidt TJ. Differential expression of CD22 (Lyb8) on murine B cells. Int Immunol. 1996; 8(7):1121-1129. (Biology). 참조 보기
  4. Law CL, Sidorenko SP, Clark EA. Regulation of lymphocyte activation by the cell-surface molecule CD22. Immunol Today. 1994; 15(9):442-449. (Biology). 참조 보기
  5. Law CL, Torres RM, Sundberg HA. Organization of the murine Cd22 locus. Mapping to chromosome 7 and characterization of two alleles. J Immunol. 1993; 151(1):175-187. (Clone-specific). 참조 보기
  6. Mary C, Laporte C, Parzy D. Dysregulated expression of the Cd22 gene as a result of a short interspersed nucleotide element insertion in Cd22a lupus-prone mice. J Immunol. 2000; 165(6):2987-2996. (Biology). 참조 보기
  7. Nitschke L, Floyd H, Ferguson DJ, Crocker PR. Identification of CD22 ligands on bone marrow sinusoidal endothelium implicated in CD22-dependent homing of recirculating B cells. J Exp Med. 1999; 189(9):1513-1518. (Biology). 참조 보기
  8. O'Keefe TL, Williams GT, Davies SL, Neuberger MS. Hyperresponsive B cells in CD22-deficient mice. Science. 1996; 274(5288):798-801. (Biology). 참조 보기
  9. Stall AM, Wells SM. FACS analysis of murine B-cell populations. In: Herzenberg LA, Weir DM, Blackwell C, ed. Weir's Handbook of Experimental Immunology. Blackwell Science Publishers; 1997:63.1-63.17.
  10. Stoddart A, Ray RJ, Paige CJ. Analysis of murine CD22 during B cell development: CD22 is expressed on B cell progenitors prior to IgM. Int Immunol. 1997; 9(10):1571-1579. (Biology). 참조 보기
  11. Symington FW, Subbarao B, Mosier DE, Sprent J. Lyb-8.2: A new B cell antigen defined and characterized with a monoclonal antibody. Immunogenetics. 1982; 16(5):381-391. (Immunogen: Immunoprecipitation). 참조 보기
모두 보기 (11) 간단히 보기
940496 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.