Skip to main content Skip to navigation
Oligo Mouse Anti-Human VISTA

BD™ AbSeq Oligo Mouse Anti-Human VISTA

Clone MIH65.rMAb (also known as MIH65) (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
VSIR; B7-H5; B7H5; C10orf54; DD1alpha; GI24; SISP1
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATCAGGGAATCTCGGTAAGTTAAACGTGTATAGTGC
AHS0187
Human VISTA Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940497 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
MIH65.rMAb

The MIH65.rMAb is a recombinant monoclonal antibody derived from MIH65 hybridoma cells. MIH65.rMAb specifically binds to human V-domain Ig suppressor of T cell activation (VISTA) like the conventional MIH65 antibody and performs like the MIH65 antibody when used to stain cells and analyze them by flow cytometry. VISTA is also known as B7-H5 (B7H5), PD-1H, DD1alpha (DD1α), chromosome 10 open reading frame 54 (C10orf54), Platelet Receptor Gi24 (GI24), or Stress induced secreted protein 1 (SISP1). VISTA is a 55-65 kDa single-pass, type I transmembrane glycoprotein that is encoded by VSIR (V-set immunoregulatory receptor) which belongs to the V-set domain containing family within the Ig superfamily. VISTA is primarily expressed on precursors and mature cells of the hematopoietic lineage including, monocytes, macrophages, neutrophils, dendritic cells (DC), T cells, regulatory T cells (Treg), and natural killer (NK) cells but not B cells. VISTA functions as an inhibitory regulator that can suppress T cell proliferation and cytokine production.

940497 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940497 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940497" on CiteAb

개발 참고 자료 (2)

  1. Bharaj P, Chahar HS, Alozie OK, et al. Characterization of programmed death-1 homologue-1 (PD-1H) expression and function in normal and HIV infected individuals.. PLoS ONE. 2014; 9(10):e109103. (Biology). 참조 보기
  2. Wang L, Rubinstein R, Lines JL, et al. VISTA, a novel mouse Ig superfamily ligand that negatively regulates T cell responses.. J Exp Med. 2011; 208(3):577-92. (Biology). 참조 보기
940497 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.