Skip to main content Skip to navigation
Oligo Mouse Anti-Human Vδ2 TCR

BD™ AbSeq Oligo Mouse Anti-Human Vδ2 TCR

Clone B6

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
TCR Vδ2
28517
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTTAGAGGGTAGAGGTCGTATAGGGTCGGCAATGT
AHS0220
Human TCR Vδ2 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu V DTA 2 TCR Olgo AHS0220 B6 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940297 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
B6

The B6 monoclonal antibody specifically recognizes the human variable δ2 subunit (Vδ2) of the γ/δ T cell receptor (TCR). The γ/δ TCR is composed of two disulfide linked glycoproteins. The delta chain is approximately 40-60 kDa and is restricted to peripheral blood T cells and thymocytes. The majority of normal peripheral blood γ/δ T cells express a Vγ9[+]/ Vδ2[+] phenotype. The reason for this selection in the T-cell repertoire is not well understood.

940297 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940297 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (4)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Breit TM, Wolvers-Tettero IL, van Dongen JJ. Receptor diversity of human T-cell receptor gamma delta expressing cells. Prog Histochem Cytochem. 1992; 26(1-4):182-193. (Biology). 참조 보기
  3. De Libero G, Rocci MP, Casorati G, et al. T cell receptor heterogeneity in gamma delta T cell clones from intestinal biopsies of patients with celiac disease.. Eur J Immunol. 1993; 23(2):499-504. (Immunogen: Flow cytometry). 참조 보기
  4. Kabelitz D. Function and specificity of human gamma/delta-positive T cells. Crit Rev Immunol. 1992; 11(5):281-303. (Biology). 참조 보기
940297 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.