Skip to main content Skip to navigation
Oligo Mouse Anti-Human Trop-2

BD™ AbSeq Oligo Mouse Anti-Human Trop-2

Clone 162-46 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
GA733-1; TROP2; EGP-1; EGP1; GP50; M1S1; TACD2
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGTATGTTTATCGGGTGAGTCGGCTGTATGGTTCC
AHS0235
Human BeWo (choriocarcinoma) Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940370 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
162-46

The 162-46 monoclonal antibody recognizes human Trop-2 which is also known as GA733-1. Trop-2 is encoded by TACSTD2 (tumor-associated calcium signal transducer 2). It is a single-pass type-1 transmembrane glycoprotein. Trop-2 was originally identified to be expressed on human trophoblast and choriocarcinoma cell lines. Trop-2 is expressed in most human carcinomas. Trop-2 appears to be involved in the transduction of an intracellular calcium signal, although the exact physiological mechanism has yet to be elucidated.

940370 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940370 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940370" on CiteAb

개발 참고 자료 (4)

  1. Bobos M, Kotoula V, Kaloutsi V, Karayannopoulou G, Papadimitriou CS, Kostopoulos I. Aberrant CCND1 copies and cyclin D1 mRNA expression do not result in the production of functional cyclin D1 protein in anaplastic large cell lymphoma. Histol Histopathol. 2009; 24(8):1035-1048. (Biology). 참조 보기
  2. Fornaro M, Dell'Arciprete R, Stella M, et al. Cloning of the gene encoding Trop-2, a cell-surface glycoprotein expressed by human carcinomas. Int J Cancer. 1995; 62(5):610-618. (Biology). 참조 보기
  3. Lipinski M, Parks DR, Rouse RV, Herzenberg LA. Human trophoblast cell-surface antigens defined by monoclonal antibodies. Proc Natl Acad Sci U S A. 1981; 78(8):5147-5150. (Immunogen: Flow cytometry, Radioimmunoassay). 참조 보기
  4. Ripani E, Sacchetti A, Corda D, Alberti S. Human Trop-2 is a tumor-associated calcium signal transducer. Int J Cancer. 1998; 76(5):671-676. (Biology). 참조 보기
940370 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.