Skip to main content Skip to navigation
Oligo Mouse Anti-Human γδ TCR

BD™ AbSeq Oligo Mouse Anti-Human γδ TCR

Clone 11F2 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
TCRgd; γδ TCR; TRG@/TRD@; TCRG/TCRD; TCR gamma delta
6964, 6965
2 µl
Mouse BALB/c IgG1
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTCGTGGGTTAGGCTTGATCGTAGTTATGTATGGTT
AHS0142
Sepharose® bead/CD3/γ/δ TCR complex
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940365 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
11F2

The 11F2 monoclonal antibody specifically reacts with a framework epitope of the γ/δ TCR. The γ/δ TCR is a heterodimeric glycoprotein that is noncovalently associated with the CD3 antigen complex. The γ and δ TCR chains are composed of constant and variable regions, each encoded by distinct gene segments. The γ chain forms either disulfide-linked or non-disulfide-linked heterodimers with the δ-subunit. TCR γ/δ is present on a minor subset of T lymphocytes in peripheral blood, thymus, spleen, and lymph node. TCR γ/δ-positive T lymphocytes comprise 1% to 9% of normal peripheral blood lymphocytes and less than 2% of normal thymocytes. The 11F2 antibody is mitogenic for γ/δ-TCR-bearing T lymphocytes.

940365 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940365 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940365" on CiteAb

개발 참고 자료 (15)

  1. Blink SE, Miller SD. The contribution of gammadelta T cells to the pathogenesis of EAE and MS.. Curr Mol Med. 2009; 9(1):15-22. (Biology). 참조 보기
  2. Bonneville M, O'Brien RL, Born WK. Gammadelta T cell effector functions: a blend of innate programming and acquired plasticity. Nat Rev Immunol. 2110; 10(7):467-478. (Biology). 참조 보기
  3. Borst J, van Dongen JJ, Bolhuis RL, et al. Distinct molecular forms of human T cell receptor gamma/delta detected on viable T cells by a monoclonal antibody.. J Exp Med. 1988; 167(5):1625-44. (Immunogen: Electron microscopy, ELISA, Flow cytometry, Fluorescence microscopy, Immunofluorescence). 참조 보기
  4. Cairo C, Hebbeler AM, Propp N, Bryant JL, Colizzi V, Pauza CD. Innate-like gammadelta T cell responses to mycobacterium Bacille Calmette-Guerin using the public V gamma 2 repertoire in Macaca fascicularis.. Tuberculosis (Edinb). 2007; 87(4):373-83. (Biology). 참조 보기
  5. Carding SR, Egan PJ. The importance of gamma delta T cells in the resolution of pathogen-induced inflammatory immune responses.. Immunol Rev. 2000; 173:98-108. (Biology). 참조 보기
  6. Chen ZW. Immune regulation of gammadelta T cell responses in mycobacterial infections.. Clin Immunol. 2005; 116(3):202-7. (Biology). 참조 보기
  7. García VE, Sieling PA, Gong J, et al. Single-cell cytokine analysis of gamma delta T cell responses to nonpeptide mycobacterial antigens.. J Immunol. 1997; 159(3):1328-35. (Biology). 참조 보기
  8. Huang D, Chen CY, Zhang M, et al. Clonal immune responses of Mycobacterium-specific γδ T cells in tuberculous and non-tuberculous tissues during M. tuberculosis infection.. PLoS ONE. 2012; 7(2):e30631. (Biology). 참조 보기
  9. Ichinohasama R, Miura I, Takahashi T, et al. Peripheral CD4+ CD8- gammadelta T cell lymphoma: a case report with multiparameter analyses.. Hum Pathol. 1996; 27(12):1370-7. (Clone-specific). 참조 보기
  10. Lanier LL, Federspiel NA, Ruitenberg JJ, et al. The T cell antigen receptor complex expressed on normal peripheral blood CD4-, CD8- T lymphocytes. A CD3-associated disulfide-linked gamma chain heterodimer.. J Exp Med. 1987; 165(4):1076-94. (Biology). 참조 보기
  11. Lanier LL, Ruitenberg J, Bolhuis RL, Borst J, Phillips JH, Testi R. Structural and serological heterogeneity of gamma/delta T cell antigen receptor expression in thymus and peripheral blood.. Eur J Immunol. 1988; 18(12):1985-92. (Biology). 참조 보기
  12. Lanier LL, Serafini AT, Ruitenberg JJ, et al. The gamma T-cell antigen receptor.. J Clin Immunol. 1987; 7(6):429-40. (Biology). 참조 보기
  13. Testi R, Lanier LL. Functional expression of CD28 on T cell antigen receptor gamma/delta-bearing T lymphocytes.. Eur J Immunol. 1989; 19(1):185-8. (Biology). 참조 보기
  14. Urban EM, Chapoval AI, Pauza CD. Repertoire development and the control of cytotoxic/effector function in human gammadelta T cells.. Clin Dev Immunol. 2010; 2010:732893. (Biology). 참조 보기
  15. Voogt PJ, Falkenburg JH, Fibbe WE, et al. Normal hematopoietic progenitor cells and malignant lymphohematopoietic cells show different susceptibility to direct cell-mediated MHC-non-restricted lysis by T cell receptor-/CD3-, T cell receptor gamma delta+/CD3+ and T cell receptor-alpha beta+/CD3+ lymphocytes.. J Immunol. 1989; 142(5):1774-80. (Biology). 참조 보기
모두 보기 (15) 간단히 보기
940365 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.