Skip to main content Skip to navigation
Oligo Mouse Anti-Human ILT-7 (CD85g)

BD™ AbSeq Oligo Mouse Anti-Human ILT-7 (CD85g)

Clone 17G10.2 (also known as 17.2)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
LILRA4; CD85g; ILT7; ILT-7; Immunoglobulin-like transcript 7
23547
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGGAGAGTGTAAGGGCGCTAGAAGTATCGATTTGT
AHS0168
ILT7–FcεRIγ-transfected 2B4 cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD85G/ILT7 Olgo AHS0168 17G10.2 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940252 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
17G10.2

The 17G10.2 monoclonal antibody specifically binds to human Immunoglobulin Like Transcript 7 (ILT7), also known as CD85g. The ILT7 protein is encoded by the LILRA4 (Leukocyte Immunoglobulin Like Receptor subfamily A member 4) gene. ILT7 is a member of immunoglobulin-like transcripts (ILT) or leukocyte immunoglobulin-like receptor (LIR) gene family. ILT7 is selectively expressed on plasmacytoid dendrtic cells (pDC) but not on myeloid dendritic cells or other peripheral blood leukocytes. In response to IL-3, IL-3 receptor complex signaling downregulates ILT7 expression by pDC. ILT7 associates with the FcεRIγ signal adapter protein to form a receptor complex that can signal through activation of an immunoreceptor-based tyrosine activation motif (ITAM)-mediated signaling pathway. Signaling through the ILT7-FcεRIγ receptor complex negatively regulates the innate immune functions of pDC. ILT7 crosslinking inhibits TLR responses by pDC such as the stimulated production of type I interferon and other cytokines. Bone marrow stromal cell antigen 2 (BST2) has been identified as a biological ligand for ILT7.

940252 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940252 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (3)

  1. Cao W, Bover L, Cho M, et al. Regulation of TLR7/9 responses in plasmacytoid dendritic cells by BST2 and ILT7 receptor interaction.. J Exp Med. 2009; 206(7):1603-14. (Clone-specific: Activation, Calcium Flux, Flow cytometry, Inhibition). 참조 보기
  2. Cao W, Bover L. Signaling and ligand interaction of ILT7: receptor-mediated regulatory mechanisms for plasmacytoid dendritic cells. Immunol Rev. 2010; 234(1):163-176. (Clone-specific: Inhibition). 참조 보기
  3. Cao W, Rosen DB, Ito T, et al. Plasmacytoid dendritic cell-specific receptor ILT7-Fc epsilonRI gamma inhibits Toll-like receptor-induced interferon production.. J Exp Med. 2006; 203(6):1399-405. (Immunogen: Activation, Calcium Flux, Flow cytometry, Functional assay, Inhibition). 참조 보기
940252 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.